Transcript

cyp2ad3-201

ID
ZDB-TSCRIPT-090929-593
Name
cyp2ad3-201
Previous Names
  • cyp2ad3-001
  • cyp2j27-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000005968 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000005968|OTTDARG00000005505|ZDB-GENE-041001-156 cyp2ad3|OTTDARP00000005343 cyp2ad3-001 LG_ BX322665.5 Danio rerio protein_coding KNOWN, 1875 bp
TGATCATTTAGAGATTGCAGGGCTCCAGACAGTACTTTTG
TATTCAGTGGCAAAGGAGAAGTTACATTTTTATCAACACA
ATGATCCTGCAGTTTATATATGAAAACTTTGATTTTAAAA
GCTGGATCCTTTTAGGATTTGGTTTACTGCTTCTTGTAGA
TTTGATTAAGTACTGGAATCCTTCCAGTTTCCCACCGGGA
CCACGACCTCTACCATTTTTAGGAAATGTCTTTACTGAAA
TTCAGGATTTCAGAAACATAAATAAGTTGGCTCAAGTCTA
TGGGACAATATTCAGCTTAAGACTAGGCAGTGAGAAATTG
ATAATTGTTTCTGGATATAAAATGGCAAAGGAGGCCCTCG
TTACTCAGAATGACAGTTTCATTGATCGTCCAAATGTTCC
TCTGTTTCACAAAGTATTTAAGGGACTTGGTACGATACTA
AGTAATGGATACCTTTGGCGGATGCATAGGAAGTTTGCAG
TCTCTCATTTGCGAAACTTTGGAGTGGGGAATGAAAGTCT
TGAGGTCAAGATCCAACAGGAGTGCATCTTCCTTTGTGAT
GCTTTTAAGGCAGAAAAGGGACCTGTCGACCCCATGGTCA
CCTTAAACAGTGCAATCTCGAATATCATTTCCAGCTTGAT
ATTTGGACAACGCTTTGACTATCATGATGAATATTACCAA
AGAATTCTGCGTCTCGACACTGAATGCATTCAGTTAGCAG
GTTCTCCTAGGGCACAGCTGTATAATGCATGTCCTTGGCT
CTTTGAATATTTACCCGGCCCTCACCAGACAATTTTTTCC
AACTATAAGAAGATCAAAGACTTCCTGAGAGGGGAGATTA
TTAAGCACAGAGAGGACTGGGACCCTGCAAACCCACGTGA
CTTTATAGACAACTACCTGACTGAGATGGAAAGGAAAAAG
AGTGACCCTGAAGCTGGTTTTAACATAGAGGGGTTAGTGG
TTACTTGTCTGGACCTGATTGAAGCCGGGACAGAGACTGC
AACTACAACCTTACGCTGGGGTCTGCTTTTTATGATCAAG
TTTCCAGAAATACAAGAAAAGGTCCAGGCAGAGATAGACA
GGGTGATTGGACAGTCACGTCAACCCTGCTTGAATGACAG
AGTTAATATGCCCTATACTGAAGCTGTGATTCATGAGATT
CAAAGATTTGGGGATGTTGTTCCACTGGGATTCCCTAAAC
GGGCTGTTAAAGACACACAACTAGGGAAATATTTCATTCC
TAAGGGCACAGCTATTACAGTAAACCTGTCTTCGGTCCTG
CATGATCCAAATGAATGGGAAACCCCAGACACCTTCAACC
CAGGACATTTCCTGGATGAAATTGGCCAGTTCCGGAAAAG
AGATGCCTTCATGCCTTTCTCTGCAGGCAAGAGAGCGTGT
TTGGGTGAAAATCTGGCTCGTCAGGAGCTTTTCTTATATT
TCACCTCTCTGCTGCAGCAGTTCAAAATCTCCAAATGTCC
AGGAGAAGAACCCAGTTTGGAAGGCGAGATTTGGTTCACG
TATGCTCCTGCTCCCTTTCACATTTGTGTGTCCTCTCGTT
AGTGTGTATACAGACATTTTTAATTAGCTCAGTCTTATTT
TTCTTTTGTGATAATTTAGTATATCTGCTATAAAGTGTTG
ATGGACCAGGATGTCCAAAGTGTTTAAGATTTTTTTTTTT
TTACCCTGATTATTTCCTAAGCATGGCCTGCAGTTATACA
AGTCTGAGACTTGTATAACATAATAAAGAGTTTAATAATG
TAATCAGGTTTCAAATATAAAGAATAGCTACCTATAGAAT
AGCTACTATATTACAATTGAAAATCATTGTAAAAATGCTT
GAAGATGTATAATAAAGCAAGGATTATTGACGTTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations