Transcript

slc25a29-202

ID
ZDB-TSCRIPT-130528-214
Name
slc25a29-202
Previous Names
  • slc25a29-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058827 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058827|OTTDARG00000037123|ZDB-GENE-050913-70 slc25a29|OTTDARP00000045942 slc25a29-002 LG_ CU682359.9 Danio rerio protein_coding KNOWN, 371 bp
ACACACACATAAGATACATACATACACACCAGCCAGCAGC
AGGTGCTAGTCGAGCTACTAGCTGAAATTTTCCACTGCCG
ATTAGTGAGTTTCAGTGAGCGCAGAGTTACCGCAGCACCA
ACATTACACTAACCACCAGCAGCTCACCGGACAGGCCTGT
GGAAATAAACTCAGATTAAGCAGCTCGACTGATCCCGAAT
CAGTCCTTGACGCGGGGATGGACTTTCTGGCTGGATGCAT
AGGAGGTCGGTTCATCTTTCTGACCAGTTCTCAGTCACGT
CTGCTGGGTCCGTCTTCAGGTTCAGAGTGTGGATAAACCT
CTTTACCGCGGTACTTTTCACTGTTTCCAGTCCATCATAC
GGCAAGAGTCG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations