Transcript

slc25a29-201

ID
ZDB-TSCRIPT-120213-804
Name
slc25a29-201
Previous Names
  • slc25a29-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052884 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052884|OTTDARG00000037123|ZDB-GENE-050913-70 slc25a29|OTTDARP00000041582 slc25a29-001 LG_ CU682359.9 Danio rerio protein_coding KNOWN, 1903 bp
ACATACACACCAGCCAGCAGCAGGTGCTAGTCGAGCTACT
AGCTGAAATTTTCCACTGCCGATTAGTGAGTTTCAGTGAG
CGCAGAGTTACCGCAGCACCAACATTACACTAACCACCAG
CAGCTCACCGGACAGGCCTGTGGAAATAAACTCAGATTAA
GCAGCTCGACTGATCCCGAATCAGTCCTTGACGCGGGGAT
GGACTTTCTGGCTGGATGCATAGGAGGTGCTGCTGGGGTG
CTGGTGGGTCATCCGTTTGACACTGTTAAGGTCCGTCTTC
AGGTTCAGAGTGTGGATAAACCTCTTTACCGCGGTACTTT
TCACTGTTTCCAGTCCATCATACGGCAAGAGTCGGTGCTG
GGTCTTTATAAAGGCATCGGTTCCCCTATGATGGGCCTGA
CGTTCATCAACGCCATCGTGTTCGGCGTGCAGGGGAATGC
CATGCGCAGACTGGGCGAAGATACGCCACTGAACCAGTTT
CTGGCGGGCGCAGCGGCCGGTTCTATCCAGTGTGTGATCT
GCTGCCCGATGGAGCTGGCCAAAACACGCATGCAGATGCA
GGGCACGGGCGAGAAGAAGTCCTCCTCCCGGAAAGTCTAC
AAGAACTCGCTGGACTGCCTGGCGCGCATTTATCAGCGTG
AGGGTTTGCGCGGCGTCAACAGAGGGATGGTGACCACGCT
AATCCGAGAAACGCCAGGATTTGGGGTTTATTTTCTGGCT
TATGATCTGCTGACGCGTTCGCTAGGCTGCGAGCCGGATG
ATCCCTACATGATCCCCAAACTCCTGTTCGCCGGCGGCAT
GTCTGGAATCGCATCCTGGTTATCCACGTACCCGGTGGAC
GTGATAAAATCACGGCTGCAGGCAGACGGAGTCGGAGGAA
AGTACCAGTACAGCAGCATTATGGACTGCACACGCAAGAG
CATCCAGCGCGAGGGCTTTCGAGTGTTCACCAGAGGACTC
ACGTCCACTCTACTGCGCGCGTTCCCGGTTAACGCGGCCA
CTTTCGCAACCGTCACCTTATTTTTGTTGTACGTTCGTCC
GGATGAAGGGTCTAAGGATTGCGAAGCTGCTCATCACGCA
ACGCTGCAGCAACAAGCGCAACCGTCCAGTCTGTGAGTAA
ATATACAGCTGTGTTTCCATTATAAATTAGATTATGTGCA
AACTTGGAATATCGCAGACATTCGCAATTTATGGGTCAAA
GAGAATCGTAAAACAATAGTGAGAGAAGTAGTGCTGTAGG
ATTCTCCACTGTGGGGTTTGTTCTCCTCTAATAAATGAGT
TGCGCCTCAGAAGACGAAACGCAATGAACGCCTTTTGAAG
GCGTGAGACGGGAGCACAGACAGATACTCAAGACGGTTCT
GGAGGTAATAATAATAGAAGAAGAATAATACTGATGACGG
ACTGATTATAAGCAGCACTACAACAATTTAGATCTTTTAC
ATCATGTCCTAACTACACGCTTCGGCTCATGTAGAAGCTT
ATTTTCAATGTTAACAAAACAAGATTTTGTCCTGAAGATG
CGTGAAAGCGATGCATGACATTTCTAATCTATTTCTGCAC
CGTCACACTAGAACAACAGCATAAACTACTATAACAATAA
TCACCGCCGCTGCTCATCATGTGCTTTATTCAGTGTTAAA
TGCTGCTAATATTTGTCCAACTTTATGGGTGTACTCACAC
TAGGCTATTCAAACCGTACCCAGACACGTTTGACCTCCAT
TTCCAGGTAGGATTGACAAATGTGAGCGCTCTGAAATCGG
GCTCAGGTGCATTTCAGTTGGCCTGGCCTGGCTGGTTGGA
AGAGGTGTGCCAGAGCGCGGTTCGGTTGGGCTTTGCCAAA
GTACGCTTGTCTTCAGTTTCGAGCTCAGGGGCGCTTACAG
TACGAGACGTGACTTTTAAGGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations