Transcript

si:dkeyp-93d12.1-202

ID
ZDB-TSCRIPT-130528-172
Name
si:dkeyp-93d12.1-202
Previous Names
  • ch211-214g8.1-002
  • si:dkeyp-93d12.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058700 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058700|OTTDARG00000006349|ZDB-GENE-041014-303 si:dkeyp-93d12.1|OTTDARP00000045854 CH211-214G8.1-002 LG_none BX000362.6,AL929119.19 Danio rerio protein_coding NOVEL, 238 bp
TGTGAGCTCGACAGATTGGACATCAGTATGTGCTTGACGT
TAGTGCATGGACGTGTCCCAGAGCTGCATCGTTAGATTGG
ATTCATGTTCTTTGGAGAATAATGGAGAGGACAAAAGAGG
AATCAAAGCTCCCTGCTCCTTGCGTATTGTGGCCTGTGGA
GCTGAAGTTGACTCACATTGACTGCAGGCCTGAAAACAAA
CTGGTACACTTTCAGGGCCAATACATGACAATCTGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations