Transcript

si:dkeyp-93d12.1-201

ID
ZDB-TSCRIPT-090929-897
Name
si:dkeyp-93d12.1-201
Previous Names
  • si:dkeyp-93d12.1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000007000 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000007000|OTTDARG00000006349|ZDB-GENE-041014-303 si:dkeyp-93d12.1|OTTDARP00000006227 CH211-214G8.1-001 LG_none BX000362.6,AL929119.19 Danio rerio protein_coding NOVEL, 6462 bp
AACATGCTGTGAGCTCGACAGATTGGACATCAGTGTAACG
TTACCTCTTGCCATTTAGGAATAACGTTAACGTTAAACGA
TTAACACATTATGAAAAGCAAAAAGTTGTATAGCTTACAG
ACTTTTTATTCCGTTATTCTCCTATTCTGTTATTTGGGAG
GTGCCACTACTAACGTTAGTCACAAAAATAGCAAGATGTG
CTTGACGTTAGTGCATGGACGTGTCCCAGAGCTGCATCGT
TAGATTGGATTCATGTTCTTTGGAGAATAATGGAGAGGAC
AAAAGAGGAATCAAAGCTCCCTGCTCCTTGCGTATTGTGG
CCTGTGGAGCTGAAGTTGACTCACATTGACTGCAGGCCTG
AAAACAAACTGGTACACTTTCAGGGCCAATACATGACAAT
CTGTGAACTGGACTACAATATTCTTCAAGTTGAAATTCAA
AATGCGGTGAAATCGAAAGTTTCTGTTCAAGTTGGAGATG
TTTGTCTGGTAGAAGACTCCGGGTCTGGTCGCTGGTACAG
AGGAAGAGTCCAGAACATTGAGAAAGATAAGTTCCACATA
TTTTTGCTGGACCATGGAGACATGATGATTGTTGGACCCA
ACTGTTTGTCCTCAATATCCGACACACTGCTAATGCTTCC
ACCTAAGATTGTCTGTGGTTTTTTTGCCAATATTCTGCCA
ATCCAGAGCCAATGGGACAGTCTGACAAACAGTTATTTCT
CTTCATTAAAAGGCAGCCGGATCAAAGGATACATTCACGC
TCGTCTACCATACCATATCCTCATACTTGAGGTTCCGGAA
ATCAATAGTGACATGATAAAAAAGAGGCTAGGGAGACATG
TGGACACCAGTACATTTTTGCTACTGGTTGAGATGCTTAT
TGATGAACCAATTCCACAAAGCAATGAATCTGTCCCCGAC
CTCTTGATAGAAAAGCAAATAGGGCAAGAATATTGCCTCA
AGTCCTCAAGCCTACTGGGCTTTGAAGAAATTCTGTCACT
TAATGGCCCAAAGTTGAAAGTTGGTCAGGAAGTAGAAGTT
GTGGTAGCTGCAGCTGTGAATCCTGGATTATTCTATTGTC
GACTCTCATCCATGGGCAAGGACCTGCAAGAAATGTCAGA
CAAATTGGCACTAGCATGTGAATCAGGCAGTGGTTGCCTG
ACCAATGACCTAGATGAAAACCTTGGTTTGCTCTGTGCAG
TAAAAGGGAAAGATGAAAAATGGCACAGGGGTTTTGTTGA
ATGCCTCCCCCTTAACTCTCAGGTCAAAGTTGTGTTTGTT
GACAGTGGCTATTGTGAATCTGTGAAAGTTGAAAACATCC
TTCAGCTACCGTCAGAATTTCTCTCAAGGCCGATCATGGC
ATTCCCATGTTCTCTTTCATGCTTGGAAAAACAAGATGAG
GACATCAAAAATCAACAAGTAGATGCTCTCAAGACTGGGT
TGCTAGGGAAAGTTTTGGAGATAGAAATCGATGACTTTCG
CAAAGATCAGAACCTCTACTTGGTCACGATGAACATTGCT
CAGAAGCACTCAGAGAAGCAAGCTGGAGTTAAACCACATG
AAAGTGACAATTTAAGGAGCAATTCCAACTTTCCTTATGA
TGTCCTTTCAAATGTGTCTGCTGGAGAGACAAAAGTGGCC
CAAACTTCAGATTCAAATCCTAATAGAGCAATACCTGATG
ATTCTTTTTTTGAGGGATATGTGGTACATGTACAGAGTCC
AAAACATTTCTGGATAAGAACCAAAGAACACAATCCTAAT
TTTGAAAACATGACAAAGGAAATGGCTGATTACTTCAGCA
AGTTACAGTTGCACGAGGAGGTTTTTGAAGACCTAGTGCC
AGGTGCACTTTGTTGTGCAATGTACGAAAATGACATGCAA
TACTACAGAGCACTTGTAGTAGATACTTTGGATAAAGGAG
CAGAGGTGTTTTTCATTGACTTCGGGAACACTGAAAAAGT
GCCAGGCATTTTAATTAAAAAGCTCCCAAAGAAGTTTGCC
ATTCATCCAGAATTTGCAATGGAATGTGCATTAGCCCATG
TAGCTCCACATGAGGACATCTGGACAACCACAGCATCCAA
TTACTTCAGGGAAGTCACATCAGACAAAACCTTGATGATT
CATGTCGTTCATAGAAAAAATAGAAAGTATGTTGTTGATC
TGTTTGAGAGAGATGCTGAAAATTGCAGCATCGCAACCAT
CATGACAACAGCTAAAATGGCCCTGGACTGGAGATACAAC
CCAGCGTTAGCATCTGTTGAAATTGAGAGGCCATGTAAAT
ACAAGGGAAATGCTCTGAGCAAGAAAAAAAATAAAAAGGA
CCTTCGTGTGGTGACCTTTCACAAAGTCACATCTTCTATG
TCCAGTCCAAATCAAATTGAACATGAATGGGAACCACAGA
ATTACCTTGAAAAACATACTCCCAGTGAGACATTGAAACC
GGAAGTTGTTCCTGCTAAGACTTTAAAACCAATGCATTTC
AAACCTGGTTCTGAAGTAAGTGTCATTTGCTCACATGTAA
ATACTCCATCTGATTTTTGGTGCCAAAATGTGAGTACAAA
ACTTGACCTGGACAAACTTATGGAAGAGATGCAGTTGTTT
TACCAAACATATACATCTGGTCTTCTGATGCCTGCATTAT
GTTGTGCTGTTAAGTCTCCACATGATAACCAGTGGCACAG
AGCATGCATGATAGGACAACACAATGAGCAACTGCTTATG
ATCCTAGTTGATGTTGGCCTAATTATTCAGGAAAAGTTGC
AAAACATCCAAACTCTTCAGCCACAGTTCCTTGAACTTCC
TACACAAGCATTTAGATGCAGATTGAACTTCATTGAACCC
ATTGGAGGGAGTTCTTGGAGTTCAGAAGCATGCAATTTGC
TCAGGGATTTTCTGTTCAAATGTACATCCAGCAAATGCAG
GATTTATTCCCAGGTTTATGAAAAAGGAAAAGGTCTACTT
AACATTGTCAGCATTCATACACCTCTTCAACAGGCCTCTA
CATACCTTGTAGAGAAAGGTGTTGCAGCAGAAGTACAAGC
TCCAGACAAGCATACAATTTCATCGGCTCACCCTTGGTCA
TTCGTTTACTCCTCTTTCAACATAAGTTGTGGAAGTGAAG
AACTGGTGCATGTTACTTATGTCTGTAGCCCTTGGGAAAT
CTATTTCCAGCTCGATAGAAATACAGAGATCCTTAATAGA
CTGACAGAGAGAGTTGCAGAGGAAAGTCAGCTCTTCACTT
CAATTTCTGACAACTGCAGCAGTAAAGTTTGCTTGGCCAA
ATATTTCTGTGACGGCAGTTGGTACAGGGCTCTGGTACAC
CCTGTTCAATCTAATCAGCATGTGAGTGTTGTCTTTGTTG
ATTATGGCAATAAGGAGATTGCAGAGAAAACAAATGTCAT
GGCAATTCCGACAACAGCAGTTGACGTATTGCTAACACCA
ATGCAGGCTCTGAGATGCAGTCTTTTGAATCTTCCAGAGG
GGGAACATTTGCCGGAAGTCAACAAGTGGCTTGAGACTGA
AATCCTCAACAAGTCTTTCAAGGCCAAGTTTGTGTCAAGC
GACACCAATGGACATTTTGTTTGTGATCTTTATGATGGCA
ATTTGCATATCAATGAAAAAGTCAAAGAGCTCATGGCTGC
TCATGGTGTGGCACAAAGTGACCTAGCTGTCAACAAACTT
GAGTTAGATTTCCCCAAAGAAGAAGCGCATGCCAGCTTAC
CGAACTGTAAACGTAACCACAAAGCAACCAGACGCAGTAA
AGCCAAACAAAATGGAAAGCAAACTCCAAGATCCACAAAC
CATTCCAAGAAGCAACTCAAGGAACCTGTTGAAATGGAAG
ACCAGAATGCTCCCTGTCCACTTAAAGTAGTGCCATCTCA
TCAGAGCTTGCCAAAACTTTGTGATCTTCCTGCTGTCACA
ATGAAACCAGGTTCTAGAGGTGTGGGCTTTGTCTCTCATA
GCATTTCTGCTGGAAGATTTTTTATCCAGATGGAAGATGA
TGAACCGAAATTACTACAGATGATTGAGGAACTAAATGGT
ACTAACTTCAAGGATAAAAGAAGAAATGTGGAAACCGAAA
TAAAAGTAGGGGACCTTGTTGCAGCAGAGTATGAAGAAGA
CTTGGCTTTGTACAGAGCTGTCGTCACCAACGTGTTAAAC
TCTGACCTACTAGCTGTTGAGTTCATTGATTATGGCAATA
CTGCAACTGTCGACAGGAAGAATGTTCACATGCTAACCAA
TACGTTTTTGTCTCAGCCCAGATTGAGCATGCCCTGCACA
CTTGCAAAACCGCACCCATTTGAAAATGATGACTCCTTTA
CGGAGAAAGCAGTTGGTAAACCCTTATTAGTTGAATTCAT
TCAAAGTCTGGAAGGTTCATGGAAAGTGAACATCGAGTTT
GACGACGACCACTTGCAAGGGGACTTGAAGTATGATGCTG
ATCATAGTAAAGATGTAGATTTGGCAAGTCAAGATAAATT
ACCAAAAGATTCCCAGACGCAAAGCCAATCTGATCAATAC
AACCAAAGTATTAAAGAAGTTCAAAGCTTCCAGCAAAAGG
AGCAGTTCAGACATCAACTTGCAAACAATCAGACTGTTAG
AACCTTCCAGCAAAAGACAACATCAAATACACAAAGCATT
TGTGAATTCAGAACCAAACCAACGGAAGTTAGAACCATCC
AGCAAAAGACCAAGTCAAACACACAACAACGTAAATGTGA
ATTGACGTTCGCAACTAAGCAAATAAAGAAAGCAGCCATA
TATGTACAAACAAGTGTCAAAACAAGGGACATTTGGAGAA
GAAAGTACAAGAAACAAAATTTCAAGCCAAAAGTTGTGGT
TAACGCAGAACCACAATGTGAGACCAGTATTCCAGTGGCT
AAAATTTCAGAAGGACTACAAGAAAATGTCCAACAAGAAA
ATAAAAACTCTGAGTCACTTGCTTGCGTTGCTCTGCATGA
TGTGAAAGACAGTGAGCCAGTAAAAATTTATGAGGATTTG
TCTGTCGTGACTGATCATCCTCCCTCCCCAAAGACTTCTT
TAAGGACCAATTTGGATCCACCACAGACCCTCTTCCAGGC
CCCTGTGAAAATGAACTTCGAATATGAAGGATTTGCAGCA
GCGGTCACAACCCCATCTGAATTTTATATCATTCTAGAGG
ATCTGCTTTTGATAGCAGATACAGTCTCATCCATTCTTGA
GAACCTTCCTGAAGTGTTGGAACCATTACCTGAAGTTCAT
TTTGTTCCTGGTACGAGCTGTTTGGTGAAATTGGTGGAGA
ATCAAAAATGGTGCAGGGCAGAGATTGTGCAATGCGATTC
AACTTCAGTGCTTATAAACTTGGTTGACTGTGGACTGTAT
TCTGTTCTGTCTCGGCTAGATGCCTCCCAGCTAAGAAAAC
TTCCTGAGGAGCTCGGTAGATTGCCTAAAGTCACCTACCA
TTGTTTACTAAGGGGAGTTAAACCCAATGCTCCAGACTGG
TCTGATGATGCCATCCTGTTTTTTCAAAACTCCATGTGTC
ACAAGAACCTTAAGATACGCTTCAGACAACATGTTTCTGA
GACACAATGGGAGGTTGACATTATCACCGGGAGTCAAAAT
CTTGCAAAGGAGTTAGTAGATTCTGATCATGCAATGTATA
TTGATAAGATGCTTGGAATCAGGTTTCAGCAAGACCAAGG
ACTCAATCAAGAGCCTAATCAACAAGCCATCTCCAGCACT
GTGAATGATTTATCAATAATAACTGAGCACACAAGCGAAG
CCAAGAAGCAGGTCACGTTGAGCGCAAAAAAGCCATCTGA
AGAATCTGTTGGAGAAAAAGACACTTCAGACCATTTGAAC
AGCGGTGGGGATGATCTTGGACAAGTGGACAGGGAAACTC
TTGGTCTACCATCAGGTATCAAACAATGTATGCTGATGTG
AGAAGACTTGTGGTTTATCTGAGAAGCCGGCGAGTTACGC
TCTGCATTGCATTCAAAGGAAAGTCAAGCTTTGCAATGGC
TGGATTTAATTGTTTATTTTTTGGTTTAACCTCTGAATAG
TGTTGTTCTCTAAAAGATGTTCTGTAGGAATGGAGAATTA
TGCTTCATACAGTAGGGAATAAATTGTGATGTTCAAACAG
TAAGATCTAAAACAATAGTACAGTTTTAACAATGCAACGC
TATATCACATTATTTTTCATAAGAGTTTTAGAACTAACAT
GTCAATTTTGGTCTTATGCATCTCTTAATGAACATGTGAT
TGATGAAATATAGCGGAGCTTAAAAGTTGCCACAATGGCT
TTACAATCTGAAAAGCAGATTTTATTTGGTAAAAAGAATT
GTCATACGACCCTGAGTTCGATTATGCTCTTTAACACACA
TTTTTAGAAATCGATTTTGCTTGTTTATTTTCATTTCTCT
TATGTGAAAATTGTGGTTTTCAGTTCTGTTGGGATGCAAA
ATAAAAATACAATGTTTTGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations