header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-130528-152
Transcript Name: adrb1-201
Previous Name: adrb1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058639 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058639|OTTDARG00000040706|ZDB-GENE-081022-145 adrb1|OTTDARP00000045822 adrb1-001 LG_ CR932360.11 Danio rerio protein_coding KNOWN, 1333 bp
ATGAACGCGCTTCTTTTCTCCAAATCATGGGAGACGGGCT
ACCGTCCGTAAACTACAGCAATGACTCTAAACGCGCCACG
GTGGATCTTAACGTTTCAGAACAGTGGCTCGTGGGCATGG
GAATCCTCATGGGTCTGATAGTGTTTGTCATTGTAGTGGG
AAATATACTGGTTATAGTCGCCATAGCGCGGAATCAGAGG
CTCCAGACGCTCACCAATGTTTTCATCGTATCTCTGGCGT
GCGCAGACCTCATCATGGGGTTACTGGTGGTGCCATTTGG
CGCAGCCCTTGAGGTCAGAGGAGCCTGGATGTATGGATCG
TTCTTCTGTGAATTCTGGATATCTCTTGATGTACTTTGCG
TCACGGCGAGCATCGAGACCCTGTGCGTAATTGCAATAGA
CAGGTATATCGCCATCATCTCTCCATTTCGCTATCAAAGC
CTTTTAACAAAAGCACGAGCCAAGGTGGTGGTGTGTGCGG
TGTGGGCTATTTCAGCCCTGGTGTCGTTTCCCCCCATCCT
AATGCACTGGTCCCAGGACAGCGAGGAGACATCGTGCTAT
GAAAATCCCGAGTGCTGTGACTTTGTCACCAACCGCGCAT
ATGCCATCTCCTCGTCCATTATATCGTTTTACATCCCTTT
AATAGTCATGATATTTGTCTATGCTAGAGTGTACAGAGAA
GCCAAACAGCAGCTGAACAAGATCAACAAATGTGAGGGAA
GGTTCTACAACAATCACGGTACAAACTGCAAACCAACCCG
AAAACGGACCACCAAGATCCTGGCTTTAAAAGAGCAGAAG
GCTCTGAAAACGCTGGGAATAATCATGGGAACGTTCACTC
TGTGTTGGCTGCCGTTCTTCATCGTGAACGTGGTGCGGGT
GTTTTGCGCACAAGTGGTGGATAAGGAGCTCTTCGTCTTT
TTGAACTGGCTGGGGTACGTCAACTCCGCATTTAATCCCA
TCATATACTGTCGGAGTCCCGACTTCAGAAAAGCCTTCAA
AAGACTGTTGTGCTGCCCGAGACAGGCGGACCGCAGGCTG
CACGTGAGTTCGTGCGATCTGTCCCGCTGCACCGGAGGCT
TTGGGAACTCGATGGAGCAGAGTATGCTCGGGACGTGGTC
GGACTGTAACGGCGCAGACAGCAGCGACTGCAGCCTGGAG
AGAAACGGCAGGATGTCCCATTCAGAGTCTCAGCTGTAAA
AGTGCAGCCGACATTATTTCATCAATATTACACGAGTGAA
AATGCCATTTGTTGAGGATATCAGGTAGGCTGGCTATAAT
TAGGAGCCAAGAGCTTGTTTTGGGGTAACGAATGAAGTTA
ACCGACAAAAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
adrb1-201 Contained in:

OTHER adrb1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058639 (1)
  • Ensembl_Trans:ENSDART00000020769 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC162821 (1) 1221 bp
    CITATIONS (2)