Transcript

adrb1-201

ID
ZDB-TSCRIPT-130528-152
Name
adrb1-201
Previous Names
  • adrb1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058639 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058639|OTTDARG00000040706|ZDB-GENE-081022-145 adrb1|OTTDARP00000045822 adrb1-001 LG_ CR932360.11 Danio rerio protein_coding KNOWN, 1333 bp
ATGAACGCGCTTCTTTTCTCCAAATCATGGGAGACGGGCT
ACCGTCCGTAAACTACAGCAATGACTCTAAACGCGCCACG
GTGGATCTTAACGTTTCAGAACAGTGGCTCGTGGGCATGG
GAATCCTCATGGGTCTGATAGTGTTTGTCATTGTAGTGGG
AAATATACTGGTTATAGTCGCCATAGCGCGGAATCAGAGG
CTCCAGACGCTCACCAATGTTTTCATCGTATCTCTGGCGT
GCGCAGACCTCATCATGGGGTTACTGGTGGTGCCATTTGG
CGCAGCCCTTGAGGTCAGAGGAGCCTGGATGTATGGATCG
TTCTTCTGTGAATTCTGGATATCTCTTGATGTACTTTGCG
TCACGGCGAGCATCGAGACCCTGTGCGTAATTGCAATAGA
CAGGTATATCGCCATCATCTCTCCATTTCGCTATCAAAGC
CTTTTAACAAAAGCACGAGCCAAGGTGGTGGTGTGTGCGG
TGTGGGCTATTTCAGCCCTGGTGTCGTTTCCCCCCATCCT
AATGCACTGGTCCCAGGACAGCGAGGAGACATCGTGCTAT
GAAAATCCCGAGTGCTGTGACTTTGTCACCAACCGCGCAT
ATGCCATCTCCTCGTCCATTATATCGTTTTACATCCCTTT
AATAGTCATGATATTTGTCTATGCTAGAGTGTACAGAGAA
GCCAAACAGCAGCTGAACAAGATCAACAAATGTGAGGGAA
GGTTCTACAACAATCACGGTACAAACTGCAAACCAACCCG
AAAACGGACCACCAAGATCCTGGCTTTAAAAGAGCAGAAG
GCTCTGAAAACGCTGGGAATAATCATGGGAACGTTCACTC
TGTGTTGGCTGCCGTTCTTCATCGTGAACGTGGTGCGGGT
GTTTTGCGCACAAGTGGTGGATAAGGAGCTCTTCGTCTTT
TTGAACTGGCTGGGGTACGTCAACTCCGCATTTAATCCCA
TCATATACTGTCGGAGTCCCGACTTCAGAAAAGCCTTCAA
AAGACTGTTGTGCTGCCCGAGACAGGCGGACCGCAGGCTG
CACGTGAGTTCGTGCGATCTGTCCCGCTGCACCGGAGGCT
TTGGGAACTCGATGGAGCAGAGTATGCTCGGGACGTGGTC
GGACTGTAACGGCGCAGACAGCAGCGACTGCAGCCTGGAG
AGAAACGGCAGGATGTCCCATTCAGAGTCTCAGCTGTAAA
AGTGCAGCCGACATTATTTCATCAATATTACACGAGTGAA
AATGCCATTTGTTGAGGATATCAGGTAGGCTGGCTATAAT
TAGGAGCCAAGAGCTTGTTTTGGGGTAACGAATGAAGTTA
ACCGACAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations