Transcript

atf6-202

ID
ZDB-TSCRIPT-130528-105
Name
atf6-202
Previous Names
  • atf6-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058493 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058493|OTTDARG00000006145|ZDB-GENE-041014-328 atf6|OTTDARP00000045723 atf6-002 LG_none BX571790.8,BX296562.4 Danio rerio protein_coding KNOWN, 937 bp
ACGTGTTGTACCTGAAGATCGGTCTCCACAGATGGCACAG
ATGTGTTTGGACAGAGATCCAGGGCTGGTGCACTGGTAGC
TGCTCATGTTGCCCAGCGGTGCCAATCCTGGCGGGGGCTT
GATGTCTTCATTGCCATTCATACTGAGAGAGTTCATCTGG
CAGACAGAAAGAAAGGACACATCTGTTCCTGACCTGAACT
TTGGCACTGAGCAACCAGCATGGAGCTCAGATGGATGGAG
AGAAACCAGCAGCCCTCGATCAGATGGGGATGTAACTGTG
GACTCACTGTCACCAAACCACACATTCAGTTCAGTGTCAT
CACCAGCGTCAGTGGAGCCTCAGTCACCGTACTCCACACA
TGATGAGGCACTGTCTCCAGACTCGTGGCGTTCCCATCCC
TCTCCGCTGTCCGTCTGCTCTGACTCCAGTGGATTTACTG
AGGCACCTAATGAGAAGAAGCCATCTAAGAGGACCAATCA
GACAAAAGCCAAACCTCTCCAACCAGCAAAAAGACCCATC
CAGGTGTGCCCCAAGGTTTCCATTCAGCCTAAACCAATCA
TTACAGCTGTTCCCATCTCCCGTCCGGCAGCCCCTCTTCA
AACCAAGATCATCATCCAGCCGCTTCAGGCCACAGTTCTG
CCTGTGGTGAAACCTCCACCTGTCACTATTCAACCAGCGC
CCCCTACAGGTCAGCTAATGCAGCTTCCTCAGCCCACTCA
GGTTCTCCAGCTTCAGACGCCTCAGTCAATGCCCACGCGT
GTAGTCACTATGCCTGCACTGGCACAGGACAGACCCATCT
CTCTTGTTGCTCCGGTAACAACATCTCCTGTGGTCACCAT
GACACTGCAAAATTCCACGCCTGACGATGATTCAAATGCG
TCTCGGAGACAGCAGCGCATGATAAAGAACAGAGAGTCAG
CTTCTCTCTCCCGGAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations