ZFIN ID: ZDB-TSCRIPT-121213-906
Transcript Name: tmem30ab-202
Previous Name: tmem30ab-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058123 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058123|OTTDARG00000004681|ZDB-GENE-030131-5884 tmem30ab|OTTDARP00000045507 tmem30ab-002 LG_ AL935145.12 Danio rerio protein_coding KNOWN, 701 bp
AAACAAACGATTTGAGAAGGCCTCGGTGAAGATAATCCAC
CCCAGCGGACATTTAAAACATTTTCACAATAATAATCACA
CGTCTGCAATCGAGTAACCGTGTGTTTTAATAGCAAAACC
CAAGCTGTGAGCTGGTAATCACAGCTATGATGGCGTCCAG
CTATAACGCGAAGGAGGAGGACGGTCATCACTCGGGAACC
GCGGGCCTCGGCGGAACCGCCATCCGGACCAGAAAGCCCG
ACAACACCGCCTTCAAACAGCAGCGCTTACCGGCCTGGCA
GCCCATCCTTACCGCGGGCACAGTTTTACCCGCTTTCTTC
GTCATCGGCCTCATCTTCATCCCAATAGGAATCGGACTCT
ACGTGACGTCCAATAATATCAAGGAGTTCGAGATTGATTA
CACCGGGACTGACATGTCCAGTCCATGTTTTAACTGCTCT
CAAAGCTTCAGCTGGAACAGCACGACTCCCTGCAAATGTA
CCCTGTCCTTCTCTCTGGACCAGCCTTTTGAAAGTAATGT
CTTCATGTACTACGGCCTCTCAAACTTCTACCAAAACCAT
CGCCGTTACGTAAAGTCCAGAGATGACAGCCAGCTTAATG
GAGATGAGCGCTCACTTAAGATACGTTGGACCTGTTTTAC
ATTGACCCCAATGGAACAAAAACCCAAATTCCGATGATCA
AAAAGGGGATCGCTTGGTGGA

tmem30ab TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA tmem30ab-201 (1) 1988
tmem30ab-202 701
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem30ab-202 Contained in:
OTHER tmem30ab-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058123 (1)
  • Ensembl_Trans:ENSDART00000152359 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK867699 (1) 721bp
    CITATIONS (2)