header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-421
Transcript Name: tmem30ab-201
Previous Names: tmem30ab-001, zgc:77655-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000005011 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000005011|OTTDARG00000004681|ZDB-GENE-030131-5884 tmem30ab|OTTDARP00000004545 tmem30ab-001 LG_ AL935145.12 Danio rerio protein_coding KNOWN, 1988 bp
CCTAGTTGACGCTTCCTGTAGCACCGCCTCTAACAAAACA
AACGATTTGAGAAGGCCTCGGTGAAGATAATCCACCCCAG
CGGACATTTAAAACATTTTCACAATAATAATCACACGTCT
GCAATCGAGTAACCGTGTGTTTTAATAGCAAAACCCAAGC
TGTGAGCTGGTAATCACAGCTATGATGGCGTCCAGCTATA
ACGCGAAGGAGGAGGACGGTCATCACTCGGGAACCGCGGG
CCTCGGCGGAACCGCCATCCGGACCAGAAAGCCCGACAAC
ACCGCCTTCAAACAGCAGCGCTTACCGGCCTGGCAGCCCA
TCCTTACCGCGGGCACAGTTTTACCCGCTTTCTTCGTCAT
CGGCCTCATCTTCATCCCAATAGGAATCGGACTCTACGTG
ACGTCCAATAATATCAAGGAGTTCGAGATTGATTACACCG
GGACTGACATGTCCAGTCCATGTTTTAACTGCTCTCAAAG
CTTCAGCTGGAACAGCACGACTCCCTGCAAATGTACCCTG
TCCTTCTCTCTGGACCAGCCTTTTGAAAGTAATGTCTTCA
TGTACTACGGCCTCTCAAACTTCTACCAAAACCATCGCCG
TTACGTAAAGTCCAGAGATGACAGCCAGCTTAATGGAGAT
GAGCGCTCACTTAAGGAACCAAGCAAAGAGTGTGAGCCGT
ACCGGATAAATGATAACAAGCGTATAGCTCCATGTGGAGC
TATTGCTAACAGCATGTTTAATGATACGTTGGACCTGTTT
TACATTGACCCCAATGGAACAAAAACCCAAATTCCGATGA
TCAAAAAGGGGATCGCTTGGTGGACGGACAAACATGTGAA
GTTCAGAAACCCTGGTGGAAACAACCCCAATCTTACTGCG
GTGTTTATTGACACAGCAAAACCGATCAACTGGCGGAAGC
CTGTCTATGAGCTGGACACTGACCCAGAAAACAACGGCTT
CATAAACGAGGATTTCATTGTGTGGATGCGCACCGCTGCC
CTGCCCACCTTCAGAAAGCTGTACCGCATTATTCAGAAGA
AGAACAACATGACACCCACACTGCCCAGAGGAAACTACAG
CCTGGAAGTCACTTACAACTATCCCGTTCGTAGCTTTGAG
GGCCGAAAGCGAATGATCCTCAGCACCATCTCCTGGATGG
GCGGAAAAAACCCCTTCCTGGGCATCGCCTACATCACAGT
GGGCTCCATCTGCTTCTTCCTCGGCGTGGTGCTCCTTTTT
ATTCACCACAAGTACGGAAACCGCAACAACAGCTCCGATA
TTCCCAGCTAAACCCATCCAGCGCATGCGTTCGCTGTGAA
TCGCATGTGCCACATTTAAAAGGTGCAAGAAAGCGTTTGA
CCACTTGATGTTCTGTTTATTTATTCCTCAAGAAGATAAA
GATGTCCGCTTGAAAGTTTTATTTTTGGCCATTTTGACTT
TAAGCGTGTTTTTTGAATGGCGAGGTGCACATACAGCTGA
TATTTTACGAAACGTCCGGGACAAAGATGAATGAAATGAA
TGTATATTTGTATTCATAGAAATTTTTACCTTCTGGCCAA
AAAGTAACAGGGCAGAATAATATGACTACTTTATTTTTAA
ACAGATAACGTTTATTCTTCGAGGGTTCGTAAAAGCGAAT
ACTGTAGCTCTGTTTACTTCCAAATATCTTCGTAGTGCCA
GAATCATTGACATTGAGCTCTCGGTGACTGTTATATGCTC
TTTGTGTTTTCTGGAGGTGCTTGTGCTTGTTTAAGGAAGC
TTTGCTGTGTGGATTTCATGGCTCACAGGGACCAAATGTT
TAGTTTATTTAACTGAATCCGTCTCGGGCTCGTTTTGGCT
GTCGTGTCTTTTTATACGTGTTCTGGTTTAAGCATGTCTG
CCTCTAACAAATAAGCACTTTAGAATGCGACAAGCCATAT
GTTTTTTGGCCGTTTTTAGGAGTGCGTGTTTTGTGTTGGG
CGAATAAAATGTCTAATTGCTGAACTTA

tmem30ab TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA tmem30ab-201 1988
tmem30ab-202 (1) 701
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tmem30ab-201 Contained in:
OTHER tmem30ab-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000005011 (1)
  • Ensembl_Trans:ENSDART00000063944 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC065436 (1) 2020bp
    GenBank:BC044384 (1) 1910bp
    GenBank:BC045515 (1) 1910bp
    GenBank:CF266390 (1) 901bp
    CITATIONS (2)