Transcript

si:dkey-4p15.3-003

ID
ZDB-TSCRIPT-121213-764
Name
si:dkey-4p15.3-003
Previous Names
  • dkey-4p15.3-003
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057221 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057221|OTTDARG00000039891|ZDB-GENE-121214-31 si:dkey-4p15.3|no_translation DKEY-4P15.3-003 LG_ CR626889.13 Danio rerio protein_coding NOVEL, 734 bp
ATGTCAAAGGGACCAGCAGTTGGCATTGATCTAGGGACCA
CCTACTCCTGTGTGGGTGTCTTTCAGCATGGCAAAGTTGA
AATCATTGCCAATGACCAGGGTAACAGGACCACACCGAGT
TATGTTGCATTCACTGACACAGAGAGACTGATTGGAGATG
CTGCCAAAAATCAAGTAGCGCTGAACCCTACAAACACAGT
CTTTGGTAAGCCATGACGTATATGTTTTAATTTGATCTGT
ATCAAAGTACTTTAAGGCATGTCATTTCACTCAGTGGCCA
TTTTTGATACTCCTCTTGGGCATGCATCCAATAGCCCCTT
TCACACAGTGATACCGGTAAATATCTGGAAAATTTCCCGA
ACGACTTTACCGGGGGAGAGAGCCATGACCAAGGACAATA
ATTTGCTTGGAAAGTTTGAGTTGACTGGAATTCCTCCGGC
TCCTCGTGGTGTTCCTCAAATTGAAGTAACCTTTGACATT
GATGCCAATGGCATCATGAATGTCTCAGCTGTAGACAAGA
GCACCGGCAAGGAGAACAAGATCACCATCACCAATGACAA
AGGACGTCTAAGCAAGGAGGACATTGAGCGCATGGTCCAG
GAAGCTGAGAAGTACAAGGCTGAGGACGATGTCCAACGAG
AAAAGGTTAGTGCCAAAAACGGCCTTGAGTCCTACTCCTT
CAACATGAAGTCCACAGTTGAGGACGAAAAACTCAAAGGC
AAGATTAGTGAAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations