ZFIN ID: ZDB-TSCRIPT-121213-761
Transcript Name: wfikkn2b-201
Previous Names: ch73-359p15.2-001, wfikkn2b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000057212 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000057212|OTTDARG00000039887|ZDB-GENE-121214-175 si:ch73-359p15.2|OTTDARP00000044858 CH73-359P15.2-001 LG_ CU695002.17 Danio rerio protein_coding NOVEL, 2378 bp
GGCTGAAGTATGAGAAGGAGCGCTATCCTGCTAAAATTAA
AGCATCTCTTTTTCTTTAGCACATTATACAATAGAGATAG
TGTTACCACAGCACAATTGAAGATATTTATTTAGAGTGTG
CTTGTAAGTTCAGTATTACCTGCGTGCAACATTGGCAGTA
ATATACTGTAAATTTTACAGTCAGTGTTCTTCATTCTGGG
ATTTTTGCACCTCCGGATAAAGGGTTAAAGCAGAGAAAGA
GAGAGAGAGAGAGAGAGGCAGGTGTCCTAGTACCAACCCC
ACGCTCAACCAGATGTTTTTAATCCTCTGTAGATCTGCAG
AGTAATTCATTACTGTCATCTGCGCGTGAGGGCGAGTTCT
GTGGTCTGGGCGATCGCCTGTGTTTCTCCAGAAGTCTAAA
CTATCAGACAGCATTTTTTTTGGTGCTGCTTGGAAGCTCA
GTTGTGGCTCAGCTGATTCAATAAAATTAGGTTAGTAGCT
TCTGAAAGCAACTCCTCATCTCTGCTCTGCAACATGTGGT
GGATGCTGTTTCCTCGCTGGATCTGGTTCGTCTTGGGACA
CTTTTTGCTGCTGTTTGTGCACCGGCAAAGCGTGAGAGGC
ATGACTTTGCAAGGAGTTGCGAATTCCCACGCAGGGATCT
GTCCAAACGACATGAACCCAAACCTGTGGGTTGATGCAAT
GAGCACCTGCAAACGGGAATGCCAAACTGACCAGGAATGT
GAACCGCTTGAGAAGTGCTGCGCCAATGTGTGCGGCAGCC
GCAGCTGTGTGGCGGCGCGCTATATAGACACTACAGGCAA
GAAAGGGCCCATGGGAATGCCAAAGGAGGCGTCCTGCGAC
CAGTTCATGTGCACGCAGCAGGGCTCCGAGTGCGACATCC
GGGACGGCCAGCCGGTCTGCAAGTGCCGCGACCGCTGCGA
GAGAGAGCCGCAGTTCACCTGCGCATCCGACGGCATGACT
TACTATAACAAGTGCTACATGGATGCAGAAGCGTGCTCTA
AAGGCATCTCATTGTCTGTGGTGTCCTGCCGTTTCCATCT
CAGCTGGCCAAACCCCAGTCCGCTTCCCTCAGGAACCACA
GCTTTACCAACAACCGCATTGCAGATCACCACTCCAGTAC
AAATGCAGGCTCCTGTGATCCTCAGCAGTCCAACACAGCA
ATCGGCATCGATCGGAGACACTGTTAGCTTTCTCTGTGAT
GTCGTAGGACATCCCGTTCCTGAGATAACCTGGCAGAAGC
AGTCGGAGAGCGTGCATATGAAACCCAATCAGGTGTACGG
AAACGTGGTGGTCACTAACATCGGTCAGCTCGTTATTTAC
AATGCACAGGTTCAGGATTCAGGTATTTACACGTGTACAG
CTGCCAACGCCGGAGGATCCGTTCAAGCAAACTTCCCACT
CTCTGTTTCAAAACCAGAAGCTGTGGTTCAAGTCAACGCC
TCCGCTGTTCCTGTTGACGAATGCTTCAAGGCTCCCGACT
CCGATGATTGTGGTGAAGAGAAGCTAAGTTGGTTTTTCGA
CCCGCAGAGAAACAGCTGCAACACCTTCACCTACAGAAAC
TGCAGCAGCAACCGCAATCACTTCGACGATTATGAATCGT
GCATGTCTTCGTGTCTGCTTAACATCTCCGCTTCTTGCAT
GCTTCCGATTCATAAGGGTCCATGCAAAGCGTATGAGCTT
CGCTGGGCGTACAGCAGCACTCTACACCAGTGCAGGCTTT
TCATCTACGGCGGATGCAAAGCCAACGAAAACAACTTCAA
ATCCAAGCGCTCCTGCGAAGATGCGTGCCCGTATCCCAAG
AATCATCAGTGCAAAGCGTGCAAACCTCGCTACAAGATGG
TGAGCAGCTTCTGCAGGAGTGATTTTGTGATTTTGGGGCG
GATGGTGGATCTCACCGAGGATCAGGACTCGGGGCGTGCG
CTGGTCATGGTGGAGGAGATACTGAAAGATGAGAAGATGG
GATTGAAGTTTTTGGGGAGCGAGCTGCTGGAGGTGACTCT
GCAGAACATGGACTGGAGCTGTCCGTGTCCCAACGTGACC
ACGTCTGACGAGCAGATCATTTTCATGGGGGACGTCCACA
ACGGGATGGCCGTATTACAGCCCGATAGCTTCATCGTCGT
CTCTAGTGTTCGCCGTGTGCAAAAACTTCGAGAGGTGGTC
AGTAAAAACACCTGTGACATTCTCAAAGAGTTCGTGCAGT
CGTGAATCTTCTGAGAAATCTGCACGGCAGAACATGCGTT
TGTCTTGTTTCTACTCCAAATGTCTTCACGTTTTCAAATC
AAGAAGCACTTTTGGAGAAGCAAATCATCTAAAATGAGTC
AACATTTATTTAAGATAAGCCTTCGGTGTCTCCAGAATGT
GTCTGTAAAGTTTCAGCT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
wfikkn2b-201 Contained in:
[BAC] CH73-359P15 (1)

Genome Resources: Vega_Trans:OTTDART00000057212 (1),  Ensembl_Trans:ENSDART00000082169 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AW566565 (1) 456 nt
CITATIONS (2)