Transcript

slc27a1b-202

ID
ZDB-TSCRIPT-121213-729
Name
slc27a1b-202
Previous Names
  • slc27a1b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052929 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052929|OTTDARG00000037165|ZDB-GENE-061013-672 slc27a1b|OTTDARP00000041624 slc27a1b-001 LG_ CU550716.20 Danio rerio protein_coding KNOWN, 2471 bp
CGTGAGCTGAGTGATGAGAGAGTTCACGAGGGTAAATAAA
TCATTGTGTGTCATTTTTCTGTTGAGTTTATCGATCATTC
TGATTTCCCAATAAGTTCTCGTCATCTGGTGCAACTCTGA
GCGTTTCTGGAGGATTTTATTCGGTCAGAGGGTTTGAAAA
GCGGTCACAAGTGAACGGGCTGATCGGGAGGAGCAAAGGA
TGGGTGCTGGAGATGGTTTTCGTGCCCCAGTCGCTCTGAT
CATTGCCGGGTTATTGAGTGCTCTGGGCGTCCCGTGGTTC
TGGAGTTTGGTGTCTCTTCTAGGAGTTTATTTATGTTCTG
GGGGATGGAGGTTTGTTTATGTGGCCGTGCGCACTGCGAA
GAGAGACCTCATTGGTCTGCAAGTGTTACTGCGCGTCAAG
TTCTACATGCGTCAGTACATCCGCAATCGCAGCACCATCC
CGTCTCTATTCGCCCAGCGGGTGGCGCTGCACCCGGAGAA
AGCGGCGCTGGTGGACGAGTCGTCAGGTGAGGTGTGGAGC
TTCTCAGAGCTGGACCGGCGCTCCAACGCAGTGGCGCAGT
GGGTGCTGGCGCAGGGCTGGCGGTCGGGTGATGTGGTGGC
CATCTTCATGGAGAGTCGCCCCCAGATGGTGGCGCTGTGG
CTCGGGATGGCTAAAGTAGGAGTGGAGCCGGCGCTCATCA
ACTTTAACCTGCGCCGTGATTCGCTGATACACTGCATGGG
CGTGTCTGGGGCGTGTGGGATGGTGTTCGGGGCGGAGCTT
TTGGATGTGGTGCTGGAGGTGAGGGAGTCTCTGCGCAGTC
TCTCGCTCTTCTCCTGTGGTTCTGCTCCTGCAGAGATGCT
GGACTCGCTGTCGGCTGCAGATCTGGACGCTCTTCTTTCC
AAATCTCCTGAAACACCACCCGCTGTCGCACACAACAAGG
GCTTCAACGACAGGTTATTTTACATCTACACCTCAGGAAC
GACGGGTTTACCTAAAGCTGCCATCGTGGTGCACAGCAGG
TATTACCGTATTGCTGCGTTCAGTTATTACTCCTTCGGTC
TGCAGCCGGATGATGTGGTGTACTGCTGTCTGCCGCTCTA
TCACTCAGCAGGGAACATCATTGGTGTTGGTCAGTGTTTG
CTGCACGGCCTGACGGTGGTCATCCGGAGGAAGTTTTCTG
CCAGTCGTTTCTGGGATGACTGTGTGAAATACAACTGTAC
GGTTGTTCAGTATATTGGTGAAATCTGCCGTTATCTCCTC
TCTCAGCCGGTGCGTCCGTCGGAGTCTCTGCACCGGGTGC
GTGTTGCCATGGGCAATGGTTTGCGGCCTAACGTTTGGGA
ATCGTTCATGAAACGCTTCAGTGTCAAGCGCATCGGTGAG
TTTTACGGAGCCACAGAGTGCAACTGCAGCCTCGCCAACA
TGGACAACAAGGTGGGTGCGTGTGGCTTCAACAGTGTGGT
TCTGCCCAGTGTTTACCCTATCAGACTGCTGAGGGCAGAC
GAGGACACTATGGAGTTAATTCGAGACAGTAGAGGACTGT
GTGTGCCATGCAAACCTGGAGAACCCGGGATTATTGTGGG
CAGAATAAATCCTCAAGATCCTCTGCGACGATTCGATGGC
TATGCGAATGAAGAGGCCACCAGTAAGAAGATCAGCCACA
ACGTCTTCAGAAAGGGAGATTCGGCGTATGTGTCAGGTGA
TCTGATGGTGATGGATGAGTTGGGTTATGTGTATTTCCGG
GATCGAGGCGGAGACACATTTCGCTGGCGGGGGGAAAACG
TCTCCACCACAGAAGTAGAGGGAGTCCTGAGTGCACTGCT
GAAGCAGACGGATGTGGCTGTGTATGGAGTCTCAGTGCCA
GGTGTGGAGGGGAAGGCAGGAATGGCTGCTATTGCAGATC
CAGAGAATGTCTTCGACTGTGAGACGTTTCTGCGGGACGT
CCAGAACGCTCTTCCTTCATACGCTCGACCTGTTTTCTTA
AGACTTTCACCTGAAGTGGACAAAACAGGCACATTTAAAA
TCCAGAAAACCCGCTTACAGAAGGAGGGATTTGACCCTCA
TCAGACCGCAGACCGGCTCTTCTTCCTCAACAGTCGTCAG
GGTCGATATGAGAGTCTGACAGAGGAGCTCCACAGCGCCA
TCATGCAGGGAAAAGTATCTCTATAAGAACTACAGAGAGT
CTTTAATGTGCAAATGTCCTAATGCAAGTGTCTTTGTTTT
ACAAAATCTCAAATAACTGCCCTAAAACCAAGCTCAAAAC
TAAACTACTGAGTTAGTGCTTGAAACTACTAGCTAAGAAA
TGAATGTCTTTGTGTTTTTTACTCTGTTTTATTGGAGATA
AGTCCATGTCTTTATTTGAGGACATCAGTTGCAGCAAATT
AATTACTTTTTTTATTCTGTGTAACATGTTTATTGAATGT
TTTGGTTAGAAACAAGGTAAGATTTTTAAGTAATGTTGTT
TTATTAATACCAATGCATTAATGCAGCTGCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations