ZFIN ID: ZDB-TSCRIPT-121213-110
Transcript Name: slc27a1b-203
Previous Name: slc27a1b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000052930 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000052930|OTTDARG00000037165|ZDB-GENE-061013-672 slc27a1b|OTTDARP00000041625 slc27a1b-002 LG_ CU550716.20 Danio rerio protein_coding KNOWN, 1635 bp
ACAAGTGAACGGGCTGATCGGGAGGAGCAAAGGATGGGTG
CTGGAGATGGTTTTCGTGCCCCAGTCGCTCTGATCATTGC
CGGGTTATTGAGTGCTCTGGGCGTCCCGTGGTTCTGGAGT
TTGGTGTCTCTTCTAGGAGTTTATTTATGTTCTGGGGGAT
GGAGGTTTGTTTATGTGGCCGTGCGCACTGCGAAGAGAGA
CCTCATTGGTCTGCAAGTGTTACTGCGCGTCAAGTTCTAC
ATGCGTCAGTACATCCGCAATCGCAGCACCATCCCGTCTC
TATTCGCCCAGCGGGTGGCGCTGCACCCGGAGAAAGCGGC
GCTGGTGGACGAGTCGTCAGGTGAGGTGTGGAGGGGAAGG
CAGGAATGGCTGCTATTGCAGATCCAGAGAATGTCTTCGA
CTGTGAGACGTTTCTGCGGGACGTCCAGAACGCTCTTCCT
TCATACGCTCGACCTGTTTTCTTAAGACTTTCACCTGAAG
TGGACAAAACAGGCACATTTAAAATCCAGAAAACCCGCTT
ACAGAAGGAGGGATTTGACCCTCATCAGACCGCAGACCGG
CTCTTCTTCCTCAACAGTCGTCAGGGTCGATATGAGAGTC
TGACAGAGGAGCTCCACAGCGCCATCATGCAGGGAAAAGT
ATCTCTATAAGAACTACAGAGAGTCTTTAATGTGCAAATG
TCCTAATGCAAGTGTCTTTGTTTTACAAAATCTCAAATAA
CTGCCCTAAAACCAAGCTCAAAACTAAACTACTGAGTTAG
TGCTTGAAACTACTAGCTAAGAAATGAATGTCTTTGTGTT
TTTTACTCTGTTTTATTGGAGATAAGTCCATGTCTTTATT
TGAGGACATCAGTTGCAGCAAATTAATTACTTTTTTTATT
CTGTGTAACATGTTTATTGAATGTTTTGGTTAGAAACAAG
GTAAGATTTTTAAGTAATGTTGTTTTATTAATACCAATGC
ATTAATGCAGCTGCACTGCAGATTTCTGTCTTGTTTCTTC
TGTTTGTTTTTGTTTTTATGGCTCACCGAGAATATAAAAA
TACATATAAACACATTTAGATCATTTACTTTAGGCAGTGC
TTTTGGACTTTTTTAAGGTGCTTTATGATATGTTGCCATT
TGACAACAACATCCAACACTTGATCTAACTTAGAAATGTC
AAATTTAGAACTTTCCTTATAATGAATAATTTAGTTGTTT
GTGTTGATTTATTAGTGTTGCAGTATTGTAAGCTTTAACA
CAGAACCTATAAATGACACCTTATACACACTTTCCAACAA
CTGATATTCCAACAGCTTACATTTATTCCATTCTTTTTGC
TGAATATTATTGAAAACAAACCTAGTATTGTATTATTATG
TATACAACATACAGTAGGTATAAATATTTCCTCCAGTAAA
TATTATAACAAATAAATAAGCCTGATATATCCAGATGCAG
CTGAATAATGTTGCTACTAGCTAATGTAGTGGTTAAAAAA
GTTTCTTTGCACATCCTTGCTGCTCTGACACATTATTTTA
ATCACCTTTTTAATTATTGAATATTTTGGTATAATCTTTG
TTGATGCAAAAGCACTCTTTTGTTTGATTACTCACTGAAT
AAGAAATTAATAAGAAAAGACATGACACTGAAAAA

slc27a1b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA slc27a1b-202 (1)    Ensembl 2471
slc27a1b-203 1635
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
slc27a1b-203 Contained in:
[BAC] CH73-221F6 (1)

Genome Resources: Vega_Trans:OTTDART00000052930 (1),  Ensembl_Trans:ENSDART00000165040 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC109455 (1) 1658 nt
CITATIONS (2)