ZFIN ID: ZDB-TSCRIPT-121213-683
Transcript Name: abcg4b-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051029 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051029|OTTDARG00000035813|ZDB-GENE-080215-10 abcg4b|no_translation abcg4b-003 LG_ CR847931.7 Danio rerio protein_coding KNOWN, 891 bp
CTTGGCAGAAGAGTACATGAACTGTCACTGACACCTGCTT
TAAATAGTAAAAGCTGTCTATTGCAGACGATCCATGCTTT
AGGATAACCTTTTATATTTATCTATTTTTCAGTTACTAAT
TTTGCTTTTCTCCATTTGCTTTTACAGGACCCGGGGCATG
TTGAGAGTCATACGTTTGCGACAAGCTCTCTGACTCAGTT
CTGCATTCTTTTCAAAAGAACATTCATTACAATATGCAGA
GACCAGGTTTTGACACATCTGCGGCTAATGTCGCATATCT
CCATTGGAGTGCTGATAGGCCTTCTATACCTCAATATTGG
CAATGATGCCAGCAAAGTCTTCAACAACACTGGCTTCCTC
TTCTTCTCAATGCTCTTTCTCATGTTTGGAGCACTGATGC
CTACAGTTCTTACTTTTCCCCTAGAGATGGCTGTGTTTCT
AAGGGAACACCTGAACTACTGGTACAGCCTAAAGGCTTAC
TATCTAGCAAAGACAATGGCTGACATTCCCTTCCAGGTCC
TCTGTCCCATTATGTATTGCAGTATTGTGTACTGGATGAC
TGAACAGCCTCCAGAGGCAAGCCGCTACTTGTTGTTTTTG
GCTTTGTCGATCTGTACAGCTTTAGTAGCCCAGTCTCTAG
GGCTCCTAGTCGGTGCTGCCTCCACATCTCTTCAGGTGGC
CACATTTGTAGGTCCAGTTACAGGTATTCCAGTCCTTCTC
TTCTCTGGTTTCTTTGTAAACTTCGACACCATTCCAGAAT
ACCTACAATGGAGTTCTTATGTGTCTTATGTCAGATACGG
ATTTGAGGGGGTGATTTTGTCCATTTATGGGATGAACCGA
ACCGAGCTCGAGTGTCCAGGGAGGGTCTGCAAGTTTCAAA
GACCTGAGGAA

abcg4b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abcg4b-201 (1)    Ensembl 2834
ncRNA abcg4b-002 (1)    Ensembl 784
abcg4b-003 891
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abcg4b-003 Contained in:
[BAC] DKEY-182I3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000051029 (1),  Ensembl_Trans:ENSDART00000152213 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN020606 (1) 949 nt
GenBank:CO798212 (1) 863 nt
CITATIONS (2)