ZFIN ID: ZDB-TSCRIPT-121213-367
Transcript Name: abcg4b-201
Previous Name: abcg4b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000051028 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000051028|OTTDARG00000035813|ZDB-GENE-080215-10 abcg4b|OTTDARP00000040107 abcg4b-001 LG_ CR847931.7 Danio rerio protein_coding KNOWN, 2834 bp
TTACAACTGACGCAGGACGTATTTGATATCTATTGTAAAA
GGAGAAAAGTGACGCACATTTCAACTCTCAATATATTTCC
CGTCGAGTGTGTGCCTGGTTTTAGGCTTTAGGCTTTTTTG
GGATGGCAGAGAAGACGTCTGATCCTGGGTCAGTTAGTAT
CGGTATGGAGGAAAGCCTGTGTAATGGAGGATCCCAGCCG
CAGGAAGCTCCACTGCTGACCCATCTAAAGAAGGTGGAGA
ACCACATCACAGAGGCGCAGCGCTTCTCTCACCTGCCCAA
ACGCACCACTGTGGAGCTGGAGTTCAAAGAGCTCTGCTAC
ACCATCAGGGAAGGACCCTGGTGGAAGAAACAAGGTTACA
AGGCTTTGCTTAAGTGTCTATCTGGGAAGTTCAGCAGTCG
GGAACTCATTGGCATTATGGGTCCTTCTGGGGCTGGAAAG
TCTACACTGATGAACATCCTGGCAGGGTACAGGGAAACAG
GGATGACTGGACAGATCCTAGTAAATGGAAAGCTCCGAGA
CCCCCGAACCTTTCGTAAAATGTCCTGTTACATTATGCAA
GAAGACAAATTGCTGCCTCACTTGTCAGTTCAAGAAGCAA
TGATGGTATCAGCCAACCTGAAGCTGAATGAAAGCTCAGA
GGTGAAAAAAGAGCTGATAAAAGAAATCCTGACAGCACTG
GGACTTCATGAATGTGTCCACACTCGTACCGTGTCTCTGT
CTGGTGGTCAGTGTAAGAGACTGGCTATTGCCCTTGAGCT
AGTAAACAACCCTCCAGTCATGTTCTTTGATGAACCCACT
AGTGGTTTGGATAGTGCCTCCTGTTTCCAGGTAGTGTCAT
TGATGAAGTCTTTGGCACAAGGAGGCCGGACCATCATTTG
CACCATTCACCAGCCCAGTGCCAAACTCTTTGAGATGTTT
GATAAGCTCTATATTTTAAGCCAAGGCCAATGTATATACA
AAGGAAGTGTCCCATACCTGATTCCTTACTTGAGAGGACT
GGGTCTTCACTGCCCCACATACCACAATCCCGCAGATTTC
ATCATTGAAGTAGCCTCAGGAGAGTACGGAGACTTAAACC
CAGTCTTGTTTGAGGCTGTTCAGGGTGGCATGTGTGCTCT
GGAGGAAAAGTGCAACTGTATCGACAAAACCACCGTAACC
TCATGCGCTGCAAAATGTGTCAAAGACCCGGGGCATGTTG
AGAGTCATACGTTTGCGACAAGCTCTCTGACTCAGTTCTG
CATTCTTTTCAAAAGAACATTCATTACAATATGCAGAGAC
CAGGTTTTGACACATCTGCGGCTAATGTCGCATATCTCCA
TTGGAGTGCTGATAGGCCTTCTATACCTCAATATTGGCAA
TGATGCCAGCAAAGTCTTCAACAACACTGGCTTCCTCTTC
TTCTCAATGCTCTTTCTCATGTTTGGAGCACTGATGCCTA
CAGTTCTTACTTTTCCCCTAGAGATGGCTGTGTTTCTAAG
GGAACACCTGAACTACTGGTACAGCCTAAAGGCTTACTAT
CTAGCAAAGACAATGGCTGACATTCCCTTCCAGGTCCTCT
GTCCCATTATGTATTGCAGTATTGTGTACTGGATGACTGA
ACAGCCTCCAGAGGCAAGCCGCTACTTGTTGTTTTTGGCT
TTGTCGATCTGTACAGCTTTAGTAGCCCAGTCTCTAGGGC
TCCTAGTCGGTGCTGCCTCCACATCTCTTCAGGTGGCCAC
ATTTGTAGGTCCAGTTACAGGTATTCCAGTCCTTCTCTTC
TCTGGTTTCTTTGTAAACTTCGACACCATTCCAGAATACC
TACAATGGAGTTCTTATGTGTCTTATGTCAGATACGGATT
TGAGGGGGTGATTTTGTCCATTTATGGGATGAACCGAACC
GAGCTCGAGTGTCCAGGGAGGGTCTGCAAGTTTCAAAGAC
CTGAGGAAGTTCTGCAGTTGTTGGATGTAGAAGATGCCAA
GCTCTACATGGACTTCATCGTACTGGGGATTTTCTTCGTC
ATCCTACGACTCGCCACATATGTGGTTCTTCGGTACAAAA
TCAAGTCAGAGCGATAATGTTCAAGCCTTGTGGGCTGATT
TCAGACTACAGTAATAACCATTTCCAAAGGTGTCATTCTC
TGCTCAGGAAGGTCAGATTGATTTGATTTATTTGATCATT
TTGGTGTACTGGTTTTTGTTTTTCATTTGGGTGAAATTAA
TCAATTGGTTGTCGATGTAATTGGCTTTAAAAATTGGAAT
ATGTATTTTTTTATGTGTTTTAATGTTACTGATGCAGTAC
CATCATGTGTCAAAAGAACTAAATCTGTTTTATGCAGGGA
TGAAATTAAAAATAAACTTGATACTAAATGTAAATTTGCA
AATGATCATTTACTGAACTTTTTAGTGTTCATTGTGGCAA
CTCATTTAACTCACACTAACACTGGTGTTTTCACTTGAAC
ACTTATTAGAGTAAATTTTATGTTTGTTTTTTTCAGTTTC
AGACATCATGAACATATTTTAGCCTTAGATGAGGATGTTT
ACATTTTATTGCACAAGTCAGAAAATGGTTTTAATTCAAA
CCAGAAGACTGCAAAGGTTCACACCGTGCCTGTGTTTCTA
TTAAACCATTTGTTCAAACTTTTTGTACAGTAGATTTTAT
AATAGTTTTCTTTTTTTAATTATTAGCATTTTTGTCTACA
GATTGTATGTAACACCCTGGTGCTACAATTAATGTATTAA
AAAACAAGTTGTAATTTTTTTAGAGAAACATATGTATATC
AGAAATGTACTACATAACAGCACTCTGCCAAATGACCTGT
ATAGTGTGTTTGGAAATAAAATGTTTGAGATCTA

abcg4b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA abcg4b-201 2834
ncRNA abcg4b-002 (1)    Ensembl 784
abcg4b-003 (1)    Ensembl 891
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
abcg4b-201 Contained in:
[BAC] DKEY-182I3 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000051028 (1),  Ensembl_Trans:ENSDART00000115051 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC153997 (1) 2778 nt
GenBank:CF348009 (1) 762 nt
CITATIONS (2)