Transcript

si:zfos-1011f11.1-003

ID
ZDB-TSCRIPT-121213-661
Name
si:zfos-1011f11.1-003
Previous Names
  • zfos-1011f11.1-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047288 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047288|OTTDARG00000033605|ZDB-GENE-080229-4 si:zfos-1011f11.1|no_translation ZFOS-1011F11.1-003 LG_ FP475876.7 Danio rerio protein_coding KNOWN, 3548 bp
GAACACTGCTGGAGCTGAGATGGCGGACACACTGCGCTTA
CTGGGCTTCATCCTGCTGAGCGGACTGCATGTGGCATCAG
CAGCGATCGTGGTTGATATCCCGCAGAAGCAGTATAAGGT
AGCGCGGGGTGATAATGCGACGCTGCCCTGCGCCTTCACC
CCGCCGCCGCCGGCCGGATCCACCACTGAGATCACCTGGA
AAGCGACTCCAGATGTGCCGGGATCTCCAATGGTGAAACA
CACACTCTACCAACATGCTGAGCTGTTATAAGCCAGTGCT
GGGTCATACACAACAATGGGTTCAAAGTTACAATTAAACT
TAAATTAAACCTTTAACCAGCAGATTTTCTCTCCATATTT
GGACCCAACAGCACATTTCTGAGTGTTTGTGTCCGTAACA
CAGTTTGTTTGCTCTGCTGTCCCCCAGATCGACATCATCA
AATTCAACAGTGCCACTGGAATGAAGGTGTACAAGAACTA
TAAGGGCCGGGCGGGTCTGACGTTTGATCTGACTAAAGGA
AAAGCCGACCTGCAGCTGGTGAGGGTCACCAGTGCCGACA
ACCGGACCTACGAGTGCCATGTGGACGTGCAGGAGGAAGA
GGACGGCACTCTATCAGACACCGCCAACCTCATTGTCCTG
GGTGAGATCACACACTACTGGCCATAACCTCTGTCATCTG
TCTGTCTAATGAAGGCAAATAATAAAAATAATCTTAAAAA
AGTCATTAAAAAGGTGAAATGTGCTGCAGATTGAGCTGTA
CAGATACGCTATATTACACAGATGCGGCTCACTCCAGAGC
CAGTGGGTGGAGCTCGACAATCCAACCACACCCTAAAGTA
ATCAATCACTAAACATAACCCCACCCATTCGGTCCACAGA
GGCGGAGCTGGACCAGTCCAGGCTCCGCCCAATACAGCCA
GAGCTGAGCCAGGCGTTGTATATTTTTAGAAATGAGCGAT
GTGTGTATAACCTCCTGTGAATACAACCTCCAACCCTCAA
TCACAAGCCCAATTCTCCAATCATAAGGTCACAGCTAGCC
TAGGCTCCACCCACTTCACTTAGAGGGGTGGAGCTTGACC
ATTTCTCACAATCTCATCAACGTCTGTCACAATCAGGCAG
CGCAGACAACACAACAACATATGAAGAGAACAACAAACGG
CTTCCTGTAGATGATGACCGCTGTTTTCTTCATCTGAGTG
CTGATGTAGTTTCATTATTCTCAGTTTGTGGGTTAGGGTT
GTTTCACGATAGTCATTAAAGTCTCTCTTGTGTCTCTGTT
GTACACCAGTGGCCCCATCAACACCCAAATGCACTATTGA
GGGGAAGACGGAGTACTTTCAGGACATCACCCTGACCTGC
AAATCGGAGGAGGGAACGCCGACACCGACCTACAAGTGGC
AAAGCTACGATGTGTTGAACAACCCTCGCCCAAACCCACT
GAAGGCCACCGACGTGAACGGCGTTCTGTCGCTCTACAAC
ATCTCTAAGGACACGTCCGGGTTCTACGTCTGCACCTCCA
CCAATGAAATCAGATCTGCCAAGTGTAATCTGACTATGGC
CGTCATGGCACCGTCCATGAGCATGGCGTCCACGGCGGGC
ATCATCGGGGCGGCGGCGGGCGCGCTGGTCCTCCTGCTGG
TCATCATCATCTGCTGCTGCTGCTGCCGGAGGAAGAAGAA
CAAGGAGGAGGAGTACGCCATGGGGACTCCTGAAGATGGA
GAATTCACAGACAAGGATCCGGAGGAGCAAGACGAACACG
TGCGGTCTGAGCAGGAGCGTCCGGTGAAGAGCGCAGACCG
CAGAGATGTGCAGGACGAGCGCAGCGAGAGGAGCTACGAC
CGCCGCAGTGACTACGACGACCGCCGAGATCCGAACACCA
GCCAGCGGGATGATCGTGATGACCGATACAATGACCGCCG
CGACCGATACGATGACAAACGCGACCGGAGTGATGACCGC
CAGGAACGCTACGATGACCGCCGGGAACGCAACGGTGACC
GCCAAGATCGTTACGATGACCGACGTGATCGCAATGATGA
CCGCAGAGATCGTTACGATGACCGCTACGATGATCGACGC
GACCGCTACGATGACCGCAGAGATCGCCATGATGACCGCT
ACGACAGCGACCGCTACTCTGACCGCTACGACAGCCGCGA
CAGACCGCCCAGCGTCCCCCCAAATAAACCCAGAGATCCG
CGGAATTGATTCGTTCCTCAGAAACGCAGGATATAGAGAT
ATCTGACATCCTGAAGCAGGAGATTTCATCCTACACACAT
GTGCTAGTGCTGACCAACATCTCCTATCGCCATATCAATC
ATCTCATATCCTGAAAACCATGCGCTCAACGATATCGCCA
TCATTCAGCAAATTCAATTAAATAATATAATTATATATCG
CGAACACACGACTGTTTCTCTTTTACATTTTAATATATTT
GCTCAAATGTGATTTTCTTTCAGGGCAAATGTTCGATTAG
GAACGTTTAAATATTAAATAACTATAATGACAGATAAAAC
ACGCTTCAAAGATATTGCGAAAGCACTGCACGTTTTCCTC
ATGCTGTTACTCTGGCTTCTGCCTGCATCCCTGTGCTGGG
TTATCCACATCCAATTGAGGAACAGGTATTGCTGTAAACG
GTGTATTTGCCACACCATAAAATAAACAAGCACAACAGGA
AACGCCATGTTGCTCAGCCCTGGTTGCGGTCTTTAACACT
TGACTCCGATTGGTCAGTCACAAAATTCCAAGGTATGTTA
TTCAGAAACTTATAAGACACTTCAAATCTTTATCTTGAGC
GTCAGTGAACACGTTCCTCCATATACGCTTCTGTTTCGCC
GCTGTTTTTGACTGTTTGGCGCCCTCTTGTGACTGAATAA
TGTGCAGGTTAGTGTATACTCCTTTCAGCTGTATTTGTTT
CTGTCAGCTTTGTCTTTAATAAATGAATGCTATATTTAGT
CTCAGAACAATGTTTATTTGTTAGATATTTACATTTTCTG
GCGAGCAGCCGTATAATAAACTGGATAAAGCACACCCAGC
CGGGGGGTTTCTCAGAATAAACCCTTCTATTGTGAATGTT
CTGTTGTTCCTCTTTGTTTCTGTTGTTGACGGGGGATTAC
CGTGAAACACATGTCTGTTAAAACTTTAAATATAGAATGA
ATATACCAGACTTCAGTTTATTTCTCTTTAATTTTGTTCT
GTTTGTAAATGAAATATTCATCATGTGTGTTGCTGGCTGT
AAGACTGGTTTAGCGGAGTTCCCGGTGCAGCTGTTTAACA
TTCAGACTTCTGTTTTCATCTGTGACAGACAGTGAAGCTG
AGTTTTGTGGCCTGACCGACCCGTTTACTTCACTTTATAT
TGCGATGATGTCACAGGAAGTGTATTTATGACAGACTGCA
TCGATCAGCTTAACCAGATCATTCTGCCTGTATAATTCAG
GGTTTTGATCTGTGCATTACTCTGTATGTTCTGATGGTGT
TTCTCACGCCATGTAGTTACTGTTACTGTTATCTGATGAT
CATTAAACATGTTTTTACTTCATGGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations