Transcript

gpa33a-206

ID
ZDB-TSCRIPT-121213-350
Name
gpa33a-206
Previous Names
  • si:zfos-1011f11.1-004
  • zfos-1011f11.1-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047290 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047290|OTTDARG00000033605|ZDB-GENE-080229-4 si:zfos-1011f11.1|OTTDARP00000037164 ZFOS-1011F11.1-004 LG_ FP475876.7 Danio rerio protein_coding KNOWN, 887 bp
GGACACACTGCGCTTACTGGGCTTCATCCTGCTGAGCGGC
TGAGATACGAGCTGGAACCGAGGGATCATCAGGATGAAAA
GAGAGGTATAGCTGGGTGTCATCAGCATAGCAGTGGTAGG
AGAATCCATGTCTCTGGATGACTGGTCCTAGAGATGATGT
GTAGATGGAGAAGAGAAGTGGCCCAAGAACAGAGCCTTGA
GGTACCCCAGTGTTTAGATGCTGTAGGTTGGACACCTCTC
CCCTCCAAGACACCCTGAATGACCTGTCAGAGAGGACTGC
ATGTGGCATCAGCAGCGATCGTGGTTGATATCCCGCAGAA
GCAGTATAAGGTAGCGCGGGGTGATAATGCGACGCTGCCC
TGCGCCTTCACCCCGCCGCCGCCGGCCGGATCCACCACTG
AGATCACCTGGAAAGCGACTCCAGATGTGCCGGGATCTCC
AATGATCGACATCATCAAATTCAACAGTGCCACTGGAATG
AAGGTGTACAAGAACTATAAGGGCCGGGCGGGTCTGACGT
TTGATCTGACTAAAGGAAAAGCCGACCTGCAGCTGGTGAG
GGTCACCAGTGCCGACAACCGGACCTACGAGTGCCATGTG
GACGTGCAGGAGGAAGAGGACGGCACTCTATCAGACACCG
CCAACCTCATTGTCCTGGTGGCCCCATCAACACCCAAATG
CACTATTGAGGGGAAGACGGAGTACTTTCAGGACATCACC
CTGACCTGCAAATCGGAGGAGGGAACGCCGACACCGACCT
ACAAGTGGCAAAGCTACGATGTGTTGAACAACCCTCGCCC
AAACCCACTGAAGGCCACCGACGTGAACGGCGTTCTGTCG
CTCTACAACATCTCTAAGGACACGTCCGGGTTCTACGTCT
GCACCTC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations