ZFIN ID: ZDB-TSCRIPT-121213-578
Transcript Name: scrn2-202
Previous Name: scrn2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058074 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058074|OTTDARG00000004555|ZDB-GENE-040724-75 scrn2|OTTDARP00000045473 scrn2-002 LG_ BX901920.9 Danio rerio protein_coding KNOWN, 772 bp
TCCGCACGACTGGCAGCATGGTGTCCATCCTCCCTCGCAA
CCCAAACATGCCCTGCGTTCACTTCCTCACTGCCACACCA
GACCCATCCAGGTCTGTATTCAAGCCTTTTATCTTTTCGG
AGAGCGTGAGGCCTGTCAGTATGGTGATGTCCCCTCAGTA
TGGCCCAGGCGACCCCGTCAGGACACTGCCTCGTTTCCAG
CACCAGGTGGACCGCAAACATGAGCTCTACAAAGCCCACC
AGATGGCCAATACCAGCTCTGATGCTGGAGTCTCTCTACA
GGACACTATGAGGTACCTTGAGTCCCAGTGTCTGGAGGAG
ATCGAGGCCATGCTGAGAGGCGAGGTTCAGGGCCAGGAGC
TTGGGGATCTGTTCTTCGACTGTGTGGACGCCGAGATCAA
ATTCTACCAGTGAAACAGTTTGTAATTGTGATTGTCACTA
GTGCTTGCTGATCTGCCTGGAGAGAGAACGAGAAAGACAG
AGAGTCCAGAGCGCACAGGTTCCTGCCTGCTCTCCTAGTT
CCCCTGATGCCATGCCAAACTAATCGTGATGTCCATGCCA
CACTAACTGTAACTTTAAAAACACACACACATTAGATGTT
GATGTGAGTGGATCACCATAACCATGTGTAATTGTCACCC
AGGGTGTTCATATATGCATCACATTAACCGGTTTGTGATA
GATTACTAAGGTGTGTATGTGCTGTGGGTAGATGTGTGAG
AGAGATGTTAGTCAAAAACACTTCTCATTCCTGTAAGAGA
CGGGCTCAGCCA

scrn2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA scrn2-201 (1)    Ensembl 1831
scrn2-202 772
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
scrn2-202 Contained in:
[BAC] CH211-184M19 (1)

Genome Resources: Vega_Trans:OTTDART00000058074 (1),  Ensembl_Trans:ENSDART00000152816 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:GO941329 (1) 772 nt
CITATIONS (2)