Transcript

scrn2-202

ID
ZDB-TSCRIPT-121213-578
Name
scrn2-202
Previous Names
  • scrn2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058074 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058074|OTTDARG00000004555|ZDB-GENE-040724-75 scrn2|OTTDARP00000045473 scrn2-002 LG_ BX901920.9 Danio rerio protein_coding KNOWN, 772 bp
TCCGCACGACTGGCAGCATGGTGTCCATCCTCCCTCGCAA
CCCAAACATGCCCTGCGTTCACTTCCTCACTGCCACACCA
GACCCATCCAGGTCTGTATTCAAGCCTTTTATCTTTTCGG
AGAGCGTGAGGCCTGTCAGTATGGTGATGTCCCCTCAGTA
TGGCCCAGGCGACCCCGTCAGGACACTGCCTCGTTTCCAG
CACCAGGTGGACCGCAAACATGAGCTCTACAAAGCCCACC
AGATGGCCAATACCAGCTCTGATGCTGGAGTCTCTCTACA
GGACACTATGAGGTACCTTGAGTCCCAGTGTCTGGAGGAG
ATCGAGGCCATGCTGAGAGGCGAGGTTCAGGGCCAGGAGC
TTGGGGATCTGTTCTTCGACTGTGTGGACGCCGAGATCAA
ATTCTACCAGTGAAACAGTTTGTAATTGTGATTGTCACTA
GTGCTTGCTGATCTGCCTGGAGAGAGAACGAGAAAGACAG
AGAGTCCAGAGCGCACAGGTTCCTGCCTGCTCTCCTAGTT
CCCCTGATGCCATGCCAAACTAATCGTGATGTCCATGCCA
CACTAACTGTAACTTTAAAAACACACACACATTAGATGTT
GATGTGAGTGGATCACCATAACCATGTGTAATTGTCACCC
AGGGTGTTCATATATGCATCACATTAACCGGTTTGTGATA
GATTACTAAGGTGTGTATGTGCTGTGGGTAGATGTGTGAG
AGAGATGTTAGTCAAAAACACTTCTCATTCCTGTAAGAGA
CGGGCTCAGCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations