Transcript

scrn2-201

ID
ZDB-TSCRIPT-090929-371
Name
scrn2-201
Previous Names
  • scrn2-001
  • si:ch211-184m19.2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000004865 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000004865|OTTDARG00000004555|ZDB-GENE-040724-75 scrn2|OTTDARP00000004416 scrn2-001 LG_ BX901920.9 Danio rerio protein_coding KNOWN, 1831 bp
GGGACTTTTATTTTGAAGCGAACGCCTGCTGCAGGTTGAT
CAGTCTCAGCTCTGCCTCTCACAGGCTCGCTGGCCGATCT
GGAGCTTATTAAGGATGGCTGAACCACCTCGGTCATGTGA
CTGTTTTGTATCTCTTCCTCCGGGTTCAAAGGAAGATTAT
GTGATATTCGGTAAAAACTCTGACCGTCCGCGGGATGAGG
TGCAAGAGGTGGTGTATTTCCCAGCGTCTTCACACCCTCC
TGCCTCCACTGTGGAGTGCACATATATCTCCATTCCTCAA
GTGGAGCACACTAATGCAGTGGTGCTGAGCAGACCTGCCT
GGCTCTGGGGCGCTGAGATGGGGGCCAATGAACACGGCGT
GTGTGTCGGAAATGAGGCCGTCTGGACCAAAGAGCCTGTG
AATCCAGAAGAGGCTCTGCTGGGAATGGACCTGGTTCGGC
TGGGTCTGGAGCGAGGGGACAGTGCTCGGGCGGCTCTGAA
TGTAATCACGGCTCTGCTGGAGCAGTTTGGTCAGGGTGGA
GCCTGCAGGGAGACCAGCGAACCCTTTAGTTATCACAACA
CCTTCTTATTAGTGGACCGACAGGAAGCATGGGTGCTGGA
GACTGCTGGGAAACTCTGGGCTGCACAGAAAGTCACAGAG
GGTGTAAAGAACATTTCTAACCAGCTGACGATAGACTTCG
AGATCTCCGCTGAGCATCCGGATCTGCGCTCTGTGGCTCA
GGCTCAGGGCTGGTGGAGTGGAGAGGGCGACTTCAGCTTC
ACTGCCGTTTTCAGCCCTGATCATCCGCCTGCCAGGATGG
AAATGGCCAAGCAACGCTACAGGGGCGGCACAGCCCTGCT
CCAGCAGCACAACGGCTCTGTGACGGCAGAGGTGATGATG
AGTATCCTGAGGGACAAGGCCAGTGGGATCTGTATGGACT
CAGAGGGTTTCCGCACGACTGGCAGCATGGTGTCCATCCT
CCCTCGCAACCCAAACATGCCCTGCGTTCACTTCCTCACT
GCCACACCAGACCCATCCAGGTCTGTATTCAAGCCTTTTA
TCTTTTCGGAGAGCGTGAGGCCTGTCAGTATGGTGATGTC
CCCTCAGTATGGCCCAGGCGACCCCGTCAGGACACTGCCT
CGTTTCCAGCACCAGGTGGACCGCAAACATGAGCTCTACA
AAGCCCACCAGATGGCCAATACCAGCTCTGATGCTGGAGT
CTCTCTACAGGACACTATGAGGTACCTTGAGTCCCAGTGT
CTGGAGGAGATCGAGGCCATGCTGAGAGGCGAGGTTCAGG
GCCAGGAGCTTGGGGATCTGTTCTTCGACTGTGTGGACGC
CGAGATCAAATTCTACCAGTGAAACAGTGTAGGTAAACAG
AAACGCCACACATCTGACCAGAGTCTTCCTCTGACTGATC
TTGCCTGTAACCTGTGGCTGTTTTGCAGTTGTAATTGTGA
TTGTCACTAGTGCTTGCTGATCTGCCTGGAGAGAGAACGA
GAAAGACAGAGAGTCCAGAGCGCACAGGTTCCTGCCTGCT
CTCCTAGTTCCCCTGATGCCATGCCAAACTAATCGTGATG
TCCATGCCACACTAACTGTAACTTTAAAAACACACACACA
TTAGATGTTGATGTGAGTGGATCACCATAACCATGTGTAA
TTGTCACCCAGGGTGTTCATATATGCATCACATTAACCGG
TTTGTGATAGATTACTAAGGTGTGTATGTGCTGTGGGTAG
ATGTGTGAGAGAGATGTTAGTCAAAAACACTTCTCATTCC
TGTAAGAGACGGGCTCAGCCACCAGACTGACCCTCTGAGG
AGAAACACAATAAAATGTCCATGGTTCAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations