ZFIN ID: ZDB-TSCRIPT-090929-371
Transcript Name: scrn2-201
Previous Names: scrn2-001, si:ch211-184m19.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000004865 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000004865|OTTDARG00000004555|ZDB-GENE-040724-75 scrn2|OTTDARP00000004416 scrn2-001 LG_ BX901920.9 Danio rerio protein_coding KNOWN, 1831 bp
GGGACTTTTATTTTGAAGCGAACGCCTGCTGCAGGTTGAT
CAGTCTCAGCTCTGCCTCTCACAGGCTCGCTGGCCGATCT
GGAGCTTATTAAGGATGGCTGAACCACCTCGGTCATGTGA
CTGTTTTGTATCTCTTCCTCCGGGTTCAAAGGAAGATTAT
GTGATATTCGGTAAAAACTCTGACCGTCCGCGGGATGAGG
TGCAAGAGGTGGTGTATTTCCCAGCGTCTTCACACCCTCC
TGCCTCCACTGTGGAGTGCACATATATCTCCATTCCTCAA
GTGGAGCACACTAATGCAGTGGTGCTGAGCAGACCTGCCT
GGCTCTGGGGCGCTGAGATGGGGGCCAATGAACACGGCGT
GTGTGTCGGAAATGAGGCCGTCTGGACCAAAGAGCCTGTG
AATCCAGAAGAGGCTCTGCTGGGAATGGACCTGGTTCGGC
TGGGTCTGGAGCGAGGGGACAGTGCTCGGGCGGCTCTGAA
TGTAATCACGGCTCTGCTGGAGCAGTTTGGTCAGGGTGGA
GCCTGCAGGGAGACCAGCGAACCCTTTAGTTATCACAACA
CCTTCTTATTAGTGGACCGACAGGAAGCATGGGTGCTGGA
GACTGCTGGGAAACTCTGGGCTGCACAGAAAGTCACAGAG
GGTGTAAAGAACATTTCTAACCAGCTGACGATAGACTTCG
AGATCTCCGCTGAGCATCCGGATCTGCGCTCTGTGGCTCA
GGCTCAGGGCTGGTGGAGTGGAGAGGGCGACTTCAGCTTC
ACTGCCGTTTTCAGCCCTGATCATCCGCCTGCCAGGATGG
AAATGGCCAAGCAACGCTACAGGGGCGGCACAGCCCTGCT
CCAGCAGCACAACGGCTCTGTGACGGCAGAGGTGATGATG
AGTATCCTGAGGGACAAGGCCAGTGGGATCTGTATGGACT
CAGAGGGTTTCCGCACGACTGGCAGCATGGTGTCCATCCT
CCCTCGCAACCCAAACATGCCCTGCGTTCACTTCCTCACT
GCCACACCAGACCCATCCAGGTCTGTATTCAAGCCTTTTA
TCTTTTCGGAGAGCGTGAGGCCTGTCAGTATGGTGATGTC
CCCTCAGTATGGCCCAGGCGACCCCGTCAGGACACTGCCT
CGTTTCCAGCACCAGGTGGACCGCAAACATGAGCTCTACA
AAGCCCACCAGATGGCCAATACCAGCTCTGATGCTGGAGT
CTCTCTACAGGACACTATGAGGTACCTTGAGTCCCAGTGT
CTGGAGGAGATCGAGGCCATGCTGAGAGGCGAGGTTCAGG
GCCAGGAGCTTGGGGATCTGTTCTTCGACTGTGTGGACGC
CGAGATCAAATTCTACCAGTGAAACAGTGTAGGTAAACAG
AAACGCCACACATCTGACCAGAGTCTTCCTCTGACTGATC
TTGCCTGTAACCTGTGGCTGTTTTGCAGTTGTAATTGTGA
TTGTCACTAGTGCTTGCTGATCTGCCTGGAGAGAGAACGA
GAAAGACAGAGAGTCCAGAGCGCACAGGTTCCTGCCTGCT
CTCCTAGTTCCCCTGATGCCATGCCAAACTAATCGTGATG
TCCATGCCACACTAACTGTAACTTTAAAAACACACACACA
TTAGATGTTGATGTGAGTGGATCACCATAACCATGTGTAA
TTGTCACCCAGGGTGTTCATATATGCATCACATTAACCGG
TTTGTGATAGATTACTAAGGTGTGTATGTGCTGTGGGTAG
ATGTGTGAGAGAGATGTTAGTCAAAAACACTTCTCATTCC
TGTAAGAGACGGGCTCAGCCACCAGACTGACCCTCTGAGG
AGAAACACAATAAAATGTCCATGGTTCAAAA

scrn2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA scrn2-201 1831
scrn2-202 (1)    Ensembl 772
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
scrn2-201 Contained in:
[BAC] CH211-184M19 (1)

Genome Resources: Vega_Trans:OTTDART00000004865 (1),  Ensembl_Trans:ENSDART00000063857 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH581014 (1) 1021 nt
GenBank:EG584401 (1) 934 nt
GenBank:CF997913 (1) 754 nt
GenBank:BI878359 (1) 685 nt
GenBank:BG306980 (1) 620 nt
CITATIONS (2)