ZFIN ID: ZDB-TSCRIPT-121213-564
Transcript Name: cgrrf1-202
Previous Name: cgrrf1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058032 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058032|OTTDARG00000004036|ZDB-GENE-040724-100 cgrrf1|OTTDARP00000045447 cgrrf1-002 LG_ AL954679.7 Danio rerio protein_coding KNOWN, 761 bp
GACAGACGCAAAGCAAGACAAGACTCAAAGCAACCGCGGT
TTAATAAAAGAAAACAGTATTTATTCGCACCGTATTAATG
TAACATTTTAAGCATGGCCGCGGAGTTTTTAGTGATGTTG
TATGAATACTCTCCTCTCTTTTATATTGCTGTTATATCAT
TGTGTTTCATCATCACTGTGGCGGTTGTGTTGGGCTGGTT
TGGGTTTGATGTTCCAGTCATTTTGCGCAGTTCAGATGAG
TCTGAATCTGTCATTCCTGTGCCTGAGAGGAAGATGGTGC
AGGTGATCAATCCCTTCGCCTTGGAGGTCAACTCTACTTC
TGCTTCAGTAACCGAGGGTGTGAGTTTGCTGCCATGCTGT
CTTGAAGACTGTGTCCTGAGCTGTTTCTGGGGCTGTGGAG
TCCAGGCTCTTCAGACGGCCCTTCAGAGTCACCAGCTTGA
GCTACGGTTCAACACTGCAGAACTGTTTCAAGAGGCTCTG
GGGTCGAGTTGCCGTCACCACCAAACATTCAAAAAGAAGA
AAGGGAAGAATATTTCACCCAGATGCCACCAGCTCTTGAA
GTAACAGATTTTGGGCTGCTTCCTCGGGATCGATACCCAT
TGGTGGCTGTGCTGACACTAGCCCATCCGGAAACCAGGGA
TAACTACAACATTGCATCTAGTGTGACTGTGATCCACGTT
CCTGATGACAAGTACAGGCTCTCCACCAGAATCTTGTTCC
AGTATCTGCTCACAGCACACGGGACCTTGTACGATCTGAA
G

cgrrf1 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript cgrrf1-202 761
mRNA cgrrf1-201 (1)    Ensembl 1402
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cgrrf1-202 Contained in:
[BAC] DKEY-63J12 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000058032 (1),  Ensembl_Trans:ENSDART00000152618 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DR729661 (1) 772 nt
GenBank:CN511486 (1) 679 nt
CITATIONS (2)