header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-564
Transcript Name: cgrrf1-202
Previous Name: cgrrf1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058032 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058032|OTTDARG00000004036|ZDB-GENE-040724-100 cgrrf1|OTTDARP00000045447 cgrrf1-002 LG_ AL954679.7 Danio rerio protein_coding KNOWN, 761 bp
GACAGACGCAAAGCAAGACAAGACTCAAAGCAACCGCGGT
TTAATAAAAGAAAACAGTATTTATTCGCACCGTATTAATG
TAACATTTTAAGCATGGCCGCGGAGTTTTTAGTGATGTTG
TATGAATACTCTCCTCTCTTTTATATTGCTGTTATATCAT
TGTGTTTCATCATCACTGTGGCGGTTGTGTTGGGCTGGTT
TGGGTTTGATGTTCCAGTCATTTTGCGCAGTTCAGATGAG
TCTGAATCTGTCATTCCTGTGCCTGAGAGGAAGATGGTGC
AGGTGATCAATCCCTTCGCCTTGGAGGTCAACTCTACTTC
TGCTTCAGTAACCGAGGGTGTGAGTTTGCTGCCATGCTGT
CTTGAAGACTGTGTCCTGAGCTGTTTCTGGGGCTGTGGAG
TCCAGGCTCTTCAGACGGCCCTTCAGAGTCACCAGCTTGA
GCTACGGTTCAACACTGCAGAACTGTTTCAAGAGGCTCTG
GGGTCGAGTTGCCGTCACCACCAAACATTCAAAAAGAAGA
AAGGGAAGAATATTTCACCCAGATGCCACCAGCTCTTGAA
GTAACAGATTTTGGGCTGCTTCCTCGGGATCGATACCCAT
TGGTGGCTGTGCTGACACTAGCCCATCCGGAAACCAGGGA
TAACTACAACATTGCATCTAGTGTGACTGTGATCCACGTT
CCTGATGACAAGTACAGGCTCTCCACCAGAATCTTGTTCC
AGTATCTGCTCACAGCACACGGGACCTTGTACGATCTGAA
G

cgrrf1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cgrrf1-201 (1) 1402
aberrant processed transcript cgrrf1-202 761
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cgrrf1-202 Contained in:
OTHER cgrrf1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058032 (1)
  • Ensembl_Trans:ENSDART00000152618 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DR729661 (1) 772bp
    GenBank:CN511486 (1) 679bp
    CITATIONS (2)