header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-230
Transcript Name: cgrrf1-201
Previous Names: cgrrf1-001, si:dkey-63j12.2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000004217 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000004217|OTTDARG00000004036|ZDB-GENE-040724-100 cgrrf1|OTTDARP00000003828 cgrrf1-001 LG_ AL954679.7 Danio rerio protein_coding KNOWN, 1402 bp
AGCGGCTGTCACAACCGGAAGTTTACGTTGGTGATTCCTG
CAGGGTGACAGACAGACGCAAAGCAAGACAAGACTCAAAG
CAACCGCGGTTTAATAAAAGAAAACAGTATTTATTCGCAC
CGTATTAATGTAACATTTTAAGCATGGCCGCGGAGTTTTT
AGTGATGTTGTATGAATACTCTCCTCTCTTTTATATTGCT
GTTATATCATTGTGTTTCATCATCACTGTGGCGGTTGTGT
TGGGCTGGTTTGGGTTTGATGTTCCAGTCATTTTGCGCAG
TTCAGATGAGTCTGAATCTGTCATTCCTGTGCCTGAGAGG
AAGATGGTGCAGGTGATCAATCCCTTCGCCTTGGAGGTCA
ACTCTACTTCTGCTTCAGTAACCGAGGGTGTGAGTTTGCT
GCCATGCTGTCTTGAAGACTGTGTCCTGAGCTGTTTCTGG
GGCTGTGGAGTCCAGGCTCTTCAGACGGCCCTTCAGAGTC
ACCAGCTTGAGCTACGGTTCAACACTGCAGAACTGTTTCA
AGAGGCTCTGGGGTCGAGTTGCCGTCACCACCAAACATTC
AATGTACAGAAAGAAGAAAGGGAAGAATATTTCACCCAGA
TGCCACCAGCTCTTGAAGTAACAGATTTTGGGCTGCTTCC
TCGGGATCGATACCCATTGGTGGCTGTGCTGACACTAGCC
CATCCGGAAACCAGGGATAACTACAACATTGCATCTAGTG
TGACTGTGATCCACGTTCCTGATGACAAGTACAGGCTCTC
CACCAGAATCTTGTTCCAGTATCTGCTCACAGCACACGGG
ACCTTGTACGATCTGAAGCCTCTATTCATGTCAGCAGACA
ACAGCAACTTATCTGGAAGCTCTGAACCTTCTCGCACTCA
AGGGGCGGAGCTACAGCCAGAAAGCTCAGGTGAAAAGGGG
GAGGAGTCTGATTCAGAAGGGGAGTGGCCTGATATTCAAG
GGCGGGACTGTGTGGTGTGTCAGAATGCATCAATAAACAG
AGTGCTTTTGCCATGCAGACATGCATGTGTATGTGACGGC
TGTGTGTGCCGCTTCCAGCACTGTCCGATCTGCCGTGCGT
TTGTCTTTGAATCATTTGCTCTGGCTAACCGACCTGCTCA
TAATGATGATGAAGATGAAGAGGATTTTACCGATTGAAAT
TGTGTGAAGATGCAGTATTAAAAGCCTTAGCTTGGAAGCA
TAAACATGAAGAAGAAACATTGTAGCATCTCTATATTGTA
AAGAGATGCAGGCAGCTGACCTGAAAATATGGACACCTCT
AGCGTTATTTCAATTTTAGACTTCTTTGACCTGAGTGTGC
TTGTGAAATGTGCTTAAGATAGAGATTTTAAGCTGTATAG
TTTATTTATTTATTTTTAATATATATATGGTAAACTAACA
AA

cgrrf1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA cgrrf1-201 1402
aberrant processed transcript cgrrf1-202 (1) 761
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cgrrf1-201 Contained in:
OTHER cgrrf1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000004217 (1)
  • Ensembl_Trans:ENSDART00000053838 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC116465 (1) 1385bp
    GenBank:EH578878 (1) 929bp
    GenBank:AL906505 (1) 539bp
    GenBank:CT643838 (1) 379bp
    CITATIONS (2)