Transcript

adcy1a-202

ID
ZDB-TSCRIPT-121213-556
Name
adcy1a-202
Previous Names
  • adcy1a-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000058008 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000058008|OTTDARG00000040416|ZDB-GENE-070705-302 adcy1a|OTTDARP00000047701 adcy1a-001 LG_none CR926131.11,CR788301.23 Danio rerio protein_coding KNOWN, 1854 bp
AAAATTTTGAATCTGCTAAGCTGGACTTCATCAGAAATCT
TCTCCTGTCTCTGCAGAGACGAGCGTTACGAACGGCTTCT
GAGAAGCTTCGTAACCGGACGTCATTTTCAGCAGGAATGG
TGCAGAATTCTCCAGGGACCCGAGTGAACCGTTATATCGG
CCGGCTGATAGAAGCACGACAGACGGAGTCAGAGATGGCA
GACCTCAACTACATCACCCTCACATACAGGAGCAGAGAAA
GAGAGCAGAGATACCAGCAAGTGTATGATGATGCCTTCAT
CAGTGCGGTGGTTATCTCGCTAGTCCTCACTTCGTTTTTT
GCAGTGGTCTATTTTCTCATCATTCCTCAAGGTCTTCTGG
TTGTAATTCTGCTGGTTCTCTGTTTATGTTTCCACATGGC
AAGTGTGATGTATCTTCACGTTACGCATGTGCAGTGCTCC
CCCGACTGCCTGACCCTACAGATCAGAACGGTTTTGTGTG
GGTTTCTGGTGCTGCTGATGTACTCTGTGACCCAGGGGTG
TGTGGTGACATGCGTGCCGTGGTCACTGGAGGGGAATTCC
AGCATCTCCATGGTGACAGTTGTCACAGTGAACGGGACCG
GCGTGGGCTACAGGGTGTGCAAATACACTCCGTATGTATT
TTTATCATGTGTGATGGCATCTCTATCTGTGGCCCTGTAC
CTACGTGTCTCATCACTACCCAAGATTCTCCTGCTTCTGC
TTCTTAACATCCTCCACACTGTCGTCATGGAGACCAGCGG
CTATCGGAAGGCCGTAGGGGGTGGATTCTTTCACACACAT
GGCTATGACCCGGTTCTAGCGATGCTGTTGTTTTCTGGAG
CTCTGGTGCTTCATTGTAGACAGCTGGATCTCAAGCTTAG
ACTGGACTACCTCTGGGCCACACAGGCTGAGGAGGAGAGA
GATGACATGGAGAGAGTGAAGCTGGACAATAAGAGGATTC
TCTTCAACCTGCTGCCTGCTCATGTCGCTCAACACTTCCT
GCTGTCCAACCCGCGAAACATGGACCTGTATTATCAGTCG
TACTCTCAGGTGGGCGTCCTGTTCGCCTCCATCCCCAACT
TTAATGACTTCTACATTGAGCTGGATGGAAACAACATGGG
TGTGGAGTGCCTCCGGCTGCTCAACGAGATCATCGCCGAC
TTTGATGCGCTGATGGATAAGGAATGCTACAGAGACATTG
AGAAGATCAAAACTATTGGAAGTACGTACATGGCTGCTGT
CGGACTCGTCCCTACTGAGGGATCTAAGGTAAAGAAGTCC
ATTTCAGCGCACCTCTGCACAGTGGCTGATTATGCCATCG
AGATGTTTGACGTCCTGGATGCCATCAACTACCAGTCCTA
CAATGACTTTGTGCTTCGAGTTGGTATTAATGTGGGTCCA
GTGGTTGCCGGAGTAATCGGGGCTCGCAGGCCTCAATACG
ACATTTGGGGAAACACAGTCAACGTCGCCAGCAGAATGGA
CAGCACTGGAGTTCAGGGAAAGATACAGGTGACAGAGGAC
GTCTTCCGCCTACTCTCGGGTTATTATGACTTCAACTGTC
GTGGCCAAGTCAGCGTAAAGGGCAAAGGTCAAATGCTCAC
CTACTTTCTGGAGGGCCGAACCCCTCAAGGTGCCCAGCAC
AGCCGATCCAAGAGTCCAGATCAAGACTCGAGTCCCTGCA
TCCGGACCAAACTGGGCTCCGCACCCGCCGTCAGCAGCTA
CGGCGTAAAGAGTCACACCGTGGGACACGTGGGCACCTCA
AACAACAGCATTCTGTACCTGCCCTCAGTGTCCGTCGACA
TGGAGATGGAGGTGTGATCGCCACATAGACGCTTCAGTGG
CGACCAATCGATGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations