Transcript

zdhhc16b-202

ID
ZDB-TSCRIPT-121213-465
Name
zdhhc16b-202
Previous Names
  • zdhhc16b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057347 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057347|OTTDARG00000039977|ZDB-GENE-040426-1301 zdhhc16b|OTTDARP00000044946 zdhhc16b-001 LG_ CU459184.9 Danio rerio protein_coding KNOWN, 3100 bp
GAACCAACAGAGCGGTTAGAGGTGCACGATATATTCAGCG
TATGTGATAATTCTCAATATGCTTAATTTTCCTACGAACA
TGACCTAAATCATGTTAAAAAACTCTTCGGGAGACTAACT
GAACGGGACCAGATTCGGGGGATGCGCAGCTGGAGGTGGT
CCGTCTCCAGGATCATGCGTCTCTTCCTGCGCTGGTTCAG
ACTCTGTCCTCGTCGGGGACACAGAAAGCGCAGCAGAGTC
CGAGACCTGTGGAATTATGGGATGGTGGTGCTGAAGTCCC
TCTACTACAACGTCCAGACCAATTCAGACACGGTGCTGGA
CTGTATGTTTGAGCCCATCTACTGGCTAGTGGACAACATG
ACCCGCTGGTTCGGAGTGGTGTTTGTGTGTCTGGTGATGG
CCTTGACCAGCTCAGTGGTGGTTATCGTGTATCTGTGTGT
TCTGCCCATCATCTTCAGCTCATATCCCGTTTACTGGATC
CTCTGGCATCTGTGTTACGGCCACTGGAATCTGCTCATGG
TCGTCTTTCATTACTATAAAGCCACGACCACACAGCCTGG
ATTCCCTCCGCAGGAAAAGACTGATATTCCGACTGTTACC
ATCTGTAAAAAATGTATAGTTCCCAAACCAGCCCGAACTC
ATCACTGCAGCATCTGCAACAGATGTATTTTGAAAATGGA
CCACCACTGTCCCTGGTTGAATAACTGCGTGGGTCACTTC
AACCACCGCTACTTCTTCAGTTTCTGTCTCTTCATGACCA
TGGGCTGCGTCTACTGCAGCATCAGTGCCAAAGACATGTT
CCTGGACGCTTACAATGCCATTGAGAGTTCGTATCAAACT
CCTCCACCTGCCTTCACTCATCAGGAACGAATGGTTCACA
AGAGTCTGGTTTACCTGTGGGTGCTGACCAGCTCAGTGGC
AGTGGCTTTGGGTGCTCTGACGTTGTGGCACGCGATTCTG
ATCACCAGAGGAGAAACCAGCGTGGAGAGACACATCAACC
GCAAGGAGAGACGACGACTCAAACTCAGGGGGAAACTTTT
CCGTAACCCGTACCATCATGGAAGAATCAACAACTGGAGG
ATATTTTTCGGTGTGGAAAAAGGAAGTGATTGGCTGTGGC
GTGTCCTCCTGCCCTCAACTCATCCTCCTCTTGGAGATGG
CCTGACATGGGACTGTCCTGCTTACAAGAGCAGCACCACC
GCCATATGAACACACACACACACACACTCAAATGAGGAGC
TTTATATCAAGTGTGTGTTTCTGCTGCAGTGTGAGATGCT
GTGTTTTTTCTAGATGTGCCGAGTTCCTCGTCGTACTTGG
TGCCAAAGGTTTTTGACAGTGACATCTGTGGAATATTTCC
ATCTTTTATATAACTTAAAGACTGATGATCATCATCATCA
TTTATCTTTGAGCGCTGTGTTTTTAACAAACTCCTGTCTT
CACTTCCTATCTGAATGTCCAAACATTTCCAGAGTGGTCC
GCGCGTTGCATTTTGTTATGTTTTATATTTGAAAATTTTA
TATTGTTATTATTTTTGTTTATGAAACAGGTCTAGATGTA
CAGAAGCTGTGACTGTGGGGTCCAGAAGTCAGAGACTATG
GAGGAAAAAAGCTACATATTGGATATTTCATAATGATTTT
TCAATTTAATTACTGTATAAATGACATTACATGCGTGATG
ATGAATTAAAATTTCAGAATTAAAAAAAAAAAAAGTAATA
TCATGGTCAAAATTGGTATAAAATGTTATTATTTATACAT
TTATTAAGTTTATTTATTATATTTTAGACGAACTTTTGCA
ATTAAGCCATTCATTAATTTTATTTTGGAGATTCGCTTAT
TTGCAACTAAACCTGAACTAATGTGTCATGATACTGGAAC
TCAATACCAATCATACTTCCATATCCAACTAACATTAGGG
CTCGTTCTTAAACAGAGCTGAGTTACCATTGTGTTCACAT
GCTCAACAGAAATGACTGTGATTGGCTGAATAAGTCATCA
GTTCACCGAACTCACCGCTAAACGCGAGCGTGGAACCTGG
TGTACGCAAAGTTGTGCGTACGCAGCGTTGATACATGAAG
CCCCCGCTGATCTTCTCGCCTTTAAAACGCTCCAATGTTC
CTGTATCTGTGGCTACACTCAGTAAACAGTAATGAGTTCG
ATGAACTGATGACCTTTACAGCCAATCACAGTCATTTCTG
TTGAGCATGTGAACACAATGACAAATCAGCGCTGTTTAAG
AACTGAACTCCAGTCTCATGACAACAACTGATAATTTCCT
GACAACATTTTTACTAAGTGTTAAAAGTCCTGAGACTTTT
GGATCCCTGGTAAACAAGCAAGTGACCAATGTTTTGTGTG
TGCGTGTTTTCAGGATTTAAGACCTTTTTTTTTATTGTAT
GACACGTTGCTGTAAATATGTGAATCGTTTGTAACATCAT
CTATCAATGCCAGCTCAGCAAACACTGTACAGATGAACTG
CTGGGATTTAAAAAACAGCAATAAAACAAGTTTCTAGTTG
GAAATTCTGACCACACCATTAATATCTTCAGCTTTTAAAC
ATAAAATATGTTGGACTTGATGTGCACGACCAGTCAAGCT
TTTGTCATCGGTAAAAAACATTCTAAAAGAAGCAGATTCT
GCTCACCAAGCCTGCATTTATTTGATCCAAAATACAGTTC
ACACTGCATATAAAATATTATTACAATTTTAATTAACTCC
TTTATTATTGAATGTAGCTTCAGATTTTATTTACACTACC
TGACAAAAGTCTTGTCGGCTATCCAAGTTTTAGGAACAAG
TAATAATAAGTTGACTTCTAGTTGATCATTTGGTGTCAGA
AGCGGTAATATGAAAGGCCTCTAGATGACGCTTATTTTAC
CAAAATAAAATATGATCATGTCTTGAATGTTAAATATTTA
ATTAGGACAGTAAGGTCTGACTCTGCTCAGACTAAAGTCT
TGTCACTGAACAGAAATAATGTCCAGTATAGAATATAAAG
TCCTGCTGCAGTGGAGACAGAGTGAGTATTGTGTCTGACT
TCATCATGAGCTTGGAGGACTGCATCCATACATCTCTGAC
TCAAATCACTCATTAATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations