Transcript

zdhhc16b-004

ID
ZDB-TSCRIPT-121213-157
Name
zdhhc16b-004
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000057349 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000057349|OTTDARG00000039977|ZDB-GENE-040426-1301 zdhhc16b|no_translation zdhhc16b-004 LG_ CU459184.9 Danio rerio protein_coding KNOWN, 911 bp
AGTTCATCCAAGTGCCGCTGAACCAACAGAGCGGTTAGAG
GTGCACGATATATTCAGCGTATGTGATAATTCTCAATATG
CTTAATTTTCCTACGAACATGACCTAAATCATGTTAAAAA
ACTCTTCGGGAGACTAACTGAACGGGACCAGATTCGGGGG
ATGCGCAGCTGGAGGTGGTCCGTCTCCAGGATCATGCGTC
TCTTCCTGCGCTGGTTCAGACTCTGTCCTCGTCGGGGACA
CAGAAAGCGCAGCAGAGTCCGAGACCTGTGGAATTATGGG
ATGGTGGTGCTGAAGTCCCTCTACTACAACGTCCAGACCA
ATTCAGACACGGTGCTGGACTGTATGTTTGAGCCCATCTA
CTGGCTAGTGGACAACATGACCCGCTGGTTCGGAGTGGTG
TTTGTGTGTCTGGTGATGGCCTTGACCAGCTCAGTGGTGG
TTATCGTGTATCTGTGTGTTCTGCCCATCATCTTCAGCTC
ATATCCCGTTTACTGGATCCTCTGGCATCTGTGTTACGGC
CACTGGAATCTGCTCATGGTCGTCTTTCATTACTATAAAG
CCACGACCACACAGCCTGGATTCCCTCCGCAGGAAAAGAC
TGATATTCCGACTGTTACCATCTGTAAAAAATGTATAGTT
CCCAAACCAGCCCGAACTCATCACTGCAGCATCTGCAACA
GATGTATTTTGAAAATGGACCACCACTGTCGTATCCTTCC
GAATCCACCATTAAATAAAACTGACCTTGCGATGTGTAGA
TGAAATGTAGTGTTTTTGCACGCGTGTTTCCGTCTTAACA
TCCTCCGCTCAGCCTGGTTGAATAACTGCGTGGGTCACTT
CAACCACCGCTACTTCTTCAGTTTCTGTCTCTTCATGACC
ATGGGCTGCGTCTACTGCAGCATCAGTGCCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations