Transcript

f10-201

ID
ZDB-TSCRIPT-121213-346
Name
f10-201
Previous Names
  • f10-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000047274 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000047274|OTTDARG00000040893|ZDB-GENE-021206-9 f10|OTTDARP00000037156 f10-001 LG_ FP017167.5 Danio rerio protein_coding KNOWN, 2727 bp
AGTATAGATAAGCTCAGACGTGTTCATATTCTCCAGTTTC
ATGATTGCGAGCGCTGCTGTTTCTCCATTTCTCCTCCCCC
TGTTCCTCTGTTTCTCTTTCTCCCTCCCAGCTCTCAGTTC
ATTGACCTTCTCTCTGTTTTCTGAACGATCTTTTAAAGTG
AAAGAGTGGACGCCGACACCGACCATGTCTTGGGTTTTCT
GGAACTTTATATCTTTGTTTGTCACCCACAGTGTGTGTGC
AGAAGTCTTCCTCAACACTCGAGATGCTAATCAGGTTCTG
ATTCGTCAGCGGCGCGCAAACTCCTTGTTCGAGGAGATGA
AGAAGGGGAACATGGAGCGCGAGTGCATTGAGGAGCGCTG
CAATTATGAGGAGGCCAGAGAAATCTTCGAAGATGTTAAA
AAGACGGATGAGTTCTGGCACAAGTATGTTGATGGAGATG
CGTGTCTGTCTCACCCGTGTGTCAACGGTGGCCAGTGTAA
AGATGCGATCGGGCCGTACACGTGTTTCTGTCAGCAAGGG
TTCAAGGGCTACAACTGCGAGATCGTGATTCCTGAACTCT
GCGAGAATGAAAACGGAGGCTGTGATCATTTCTGTGAGGT
GATGGAGAAGAATGTGGTCTGCTCGTGTGCTAATGGATAT
GAACTGGCCCCCAACGGGAAATCCTGCCAGTCTCAGGATC
CATTCAAATGTGGCGTCATTTATCCAAAGAAGACCAGAAG
CATCTTCTTCCACACGCCGAACATCACCGAAAGCGAGAAC
GAAGAAGAGACGGAGCTGGAGGCCACCATAGAGCCGGTCT
ACAACCACTCGAACCCACTGAACAACCAGACCGACAGCAT
GTTCGGGCTCCACGAGCTGGAGATTATCGAGGAGGAACCA
ATCCTACCGGTGGTGTCCACAGCCGGAGACGGGAGGATCG
TGAACGGTGTGGAGTGTCCACCTGGAGACTGTCCATGGCA
GGCTCTCCTCATCAATGAAAATAACATGGGCTTCTGTGGC
GGCACCATCCTGACCGAACACTTCATCCTGTCGGCCGCGC
ACTGCATGAACGAGTCGCTCTCCATCAGGGTGGTTGTAGG
TGAGTACGACACGCTGGTCCCTGAGGGTCGCGAGGCCACG
CATGATGTAGATGAGATTCTGATCCACAAGAACTACCAGC
CTGACACCTACCACAACGACATCGCCCTCATCAAGCTCTC
GAAACCCATCAAATTCACCAAATACATCATCCCCGCGTGT
CTGCCGGAGATGAAGTTCGCTGAGCGTGTGCTGATGCAGC
AGGATGACGGTCTGGTGAGCGGGTTCGGCCGCGTGCGTGA
GGGAGGCCTGTCGTCCACCATCCTGCAGAAACTAACCGTG
CCGTACGTCAACCGCGCTAAATGCATCGAGTCCAGCAATT
TCAAGATCTCCGGCCGCATGTTCTGCGCCGGATACGACCA
GGAGGAGAAAGATGCATGTCAGGGGGACAGCGGCGGGCCG
CACGTCACGCGCTTCAAAAACACCTGGTTTATCACAGGTG
TGGTGAGCTGGGGCGAAGGGTGCGCGCGCAAGGGGAAATA
CGGCGTCTACACACAGGTCTCCAAATACATCATGTGGATC
AATAACGCAATGACGAAAGTCATGCCAGAGACCGGAGCGT
CTTTAAAACCCAAAGCAAAGCGAGAGCTGCGGCACAAGAC
ACCAATAAGAAGAGTCTGACTCCTCTGAGGAAAGCCTCAT
CTTTCATATGCATTTAATTACTCAGTCCACTAACAGCACA
GGGCTCAAACTCAACTCCTGGAGGGCCGCTGCTCTGCACA
GTTTTGCTCCAACCCTACTCAGACACACCTGATCCAGGTA
ATCAAGGTGTTCAGACTACTCTGAGTGGATCAGCTGTGTT
TGAGTAGGGTTGGAGCAAAGCTGTGCAGAGCTGCAGCCCT
CCAGGAGTTGAGTTTGAGCCCTGTGCTTTAAGGGAGAGTT
CACCCAAAAGTTACTCGTCCTTTACCAGCTTCTAGTTTTC
TGTTATAAAACAAAAGAAGAAGTTCTGAAGAATGTTGAAC
ACCTTTATCTATTGGTTTTTATTCTTACTATGGAGGTCAG
TGGTGTAACTTAAAAGTATGAATATTAATAATTAATGATA
ACAAGTTGCAATTTAATTATGAATATTTTAATTTTAATCG
GATTTCATTACAATGGCTACAGGCTTTTGGCTTTCTTTAG
AATATTTTCTTTTGTGTTTAAAAGAAGAAAGAAACTCTTA
AATGTTTGGCAGTAAATAGTGGGTAAATGTAGATTTTTGG
GTGAACTGTGGCTTTAGTGTAATCCTCATGTGTATTAATA
TCATGGTATTTCTAGTAAAATCACATTATGGAGGTAGAAT
GGTTCATCAATGCTTCGACCATCATCCAGATGAGATGTCT
GAGTTTTAATAAAGATGATAAACTGATTCTATGAGCTGTT
TCACTCATGTTTTTAGTCAAATACAGATTATAGATGAAGT
CGAAGGCAACATTATTTACTCTCCAGTGAAATTTTCTTTA
ATACTTTTTCTTCTGCAGAAAGTTTATTTTAGTTTGGCTG
TTGTTCATTTTTTAAGATCAATTTTTAAGATATTTAACAT
TAAGATAATTTTTTTAGTCCACAATCTACAAATTTATCTA
CAGAGCAAACCACTGTTGTCAAATTAACTTAGTTAAGCCT
TAATTGAATACTACTTTAAGCTGAATACTAGTATCTTGAA
AAATAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations