header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-280
Transcript Name: ptenb-201
Previous Names: ptenb-002, rp71-1g13.4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058109 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058109|OTTDARG00000001921|ZDB-GENE-030616-47 ptenb|OTTDARP00000045499 RP71-1G13.4-002 LG_ AL731788.8 Danio rerio protein_coding KNOWN, 1947 bp
TGATGGAAGTTTGAGAGTGTAACAGGCAGTGGAGCAGTGG
AGGATAAGGACAGAACCGGAGGTGTCTCTTACGCCACATT
TAAATATCGAGTTTTTCATTTCTTGGTGGAGGCTGTCACA
TTTTGTTTCATGTGTTGGAACCTGGTCATCGCGGATTGTC
GTAGAGTTTAATGGCTTTTATTTTCTAAGGATGTGTAGAC
GGGCTAGCGCGTTAGCCGTTGAGGCTAGACGGAGCGCGAG
CTGAGTGCGAGCGGGGCTCTGACGACCGATCTTCAAGTGG
AAGCACCGGAGAGGATTTTCTCTCCGCCTTTCCGCTCAAT
CACGGCGGCTTCGGTGCGACCAGAGACTTGTCGTGCACTA
GAGATTCTGCAGTTCCAGACGTGGGAAGTTGCTTATCTTT
TCACCCAGGGCTCGTCTGAGCCGAGGAGGGCATTTTGGAA
GCCGGGCCTGTGGTGGTTTGGAGCGAGGCCCTTGATGAGT
GAGCCACAGCAGACTCCATTCTAGCTAGCTGGGGGACTGC
GAAACGAGCAGAGCATAAAGACGACCGACCGTCCGAAAGC
AACAATACTCTCTCTCACACTAAAAACCCTAAAGACTCCT
GTCACAGCCATGGCTGCGATCATAAAGGAATTTGTCAGTA
GAAATAAAAGGAGATACCAAGAAGACGGGTTCGACTTGGA
CTTGACATACATTTATCCTAACATAATAGCTATGGGTTTC
CCTGCTGAAAGACTGGAGGGTGTATATAGAAACAACATAG
ATGATGTAGTGAGGTTTCTTGATTCAAAGCATAAAGATCA
TTACAAGATATATAACCTATGTGCAGAAAGACATTACGAT
ACTGCCAAATTTAACTGCAGAGTTGCACAGTATCCATTTG
AGGATCACAATCCTCCTCAGCTAGAGCTCATTAAACCTTT
CTGTGAAGATTTGGATAAATGGCTCAGTGAAAATGACAAT
CATGTGGCTGCCATTCACTGCAAAGCTGGAAAGGGAAGAA
CGGGTGTCATGATTTGTGCGTACTTGTTACACCGAGGCAA
ATTCAAAAAAGCACAAGAGGCTCTGGACTTCTACGATGAA
GTTAGGACCAGAGACAAGAAGGGAGTGACTATTCCCAGTC
AGAGGCGATATGTATACTACTATAGCTACCTTCTGAGGAA
TAAGCTGGAGTACAAACCTGTGGCCTTGCTCTTTCACAAG
ATGGTGTTTGAGACAGTGCCTATGTTCAGTGGAGGGACCT
GCAGGGATTCTGCTGTAAAAAGCAAGAGTGAGCAGATTCC
ACATGGGTTCAGAAAAACCAATTGGCATTGGGATCCTCAG
TTTGTGGTGTACCAGCTGAAGGTGAAAATTCACACCTCAA
ACCCAGCGCACACAAGAAGAGAGGAGAAGTACATGTTCTT
CGAATTTCCTCAACCACTGCCTGTGTGTGGGGACATCAAG
GTGGAGTTCTTCCACAAACAAAACAAGATGATGAAGAAGG
AGAAAATGTTCCACTTCTGGGTGAACACCTTTTTCATCCC
TGGGTCAGAGGAGAGCACAGAGAAAGTGGAAAATGGAGGT
TTAGTGAAGGACCTGGATGGAATACAAACAGCAGAGAGAG
GAGAGAATGACAAAGACTATTTAATTCTTACTTTAAGTAA
GACGGATTTGGATAAAGCGAACAAGGATAAAGCCAACAGA
TACTTCTCTCCCAATTTTAAAGTTAAAATGTTTTTTACGA
AAACAGTGGAGGAACCATCCAACTCAGAGGCCAGCACTTC
TACTTCTGTAACCCCGGATGTTAGCGATAATGAACCGGAC
CATTATCGTTATTCGGACACAACAGACTCAGACCCTGAAA
ATGAACAGTACGATGAAGAACAGATTACTAAAGTTTGAAA
TATTTTTATGGGAAGAAAAAAGTAAACATGCGTAACAGAG
TTGTATAAAGGAGAAAACTTGAATATG

ptenb TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ptenb-201 1947
ptenb-202 (1)    Ensembl 3380
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptenb-201 Contained in:
[BAC] RP71-1G13 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000058109 (1),  Ensembl_Trans:ENSDART00000079138 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC093110 (1) 1482 bp
GenBank:AY398670 (1) 1303 bp
GenBank:EH575536 (1) 875 bp
CITATIONS (2)