header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-121213-255
Transcript Name: psmc6-202
Previous Name: psmc6-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000058031 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000058031|OTTDARG00000004035|ZDB-GENE-030131-304 psmc6|OTTDARP00000045446 psmc6-002 LG_ AL954679.7 Danio rerio protein_coding KNOWN, 834 bp
ACGAAGAAGCGCGAGAGCGAAGCGGCAGTGAACATGGCGG
AAAACAGGGAGAAAGGTTTACAAGACTACAGAAAGAAATT
ACTGGAGCATAAAGAGATTGACGGGCGCCTCAAAGAGTTG
AGAGAGCAGCTGAAGGAGCTCACTAAACAATATGAGAAGT
CTGAGAATGACCTGAAGGCTTTACAGAGTGTGGGGCAGAT
TGTCGGTGAAGTGCTGAAACAGCTGACTGAGGAGAAATTT
ATTGTTAAAGCAACTAATGGACCACGATATGTGGTTGGAT
GTCGCAGACAGCTGGATAAATCCAAGCTGAAGCCTGGCAC
TAGAGTGGCTCTGGACATGACAACTCTCACTATCATGAGG
TATTTGCCTCGTGAGGTGGATCCTCTAGTGTACAACATGT
CCCATGAAGACCCTGGTAGCGTTTCATACTCTGAGATTGG
TGGACTGTCTGAGCAGATTCGTGAGCTGAGAGAGGGTGGG
CATTATTCCTCCCAAAGGCTGCCTGCTCTACGGACCTCCA
GGCACTGGAAAGACTCTTCTTGCCAGAGCTGTGGCCAGTC
AGTTGGACTGCAATTTCCTTAAGGTTGTGTCCAGCTCCAT
TGTTGACAAGTACATTGGTGAGAGTGCCAGACTCATCAGA
GAGATGTTCAACTACGCCAGAGACCATCAGCCCTGCATCA
TCTTCATGGACGAGATCGATGCTATTGGTGGACGTCGGTT
TTCTGAAGGAACCTCAGCTGATAGAGAGATCCAGAGGACA
CTGATGGAGCTGCTGAATCAGATGGATGGATTCGACACTC
TTCATAGAGTCAAGATGATCATGGCCACCAACCG

psmc6 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA psmc6-201 (1) 1561
aberrant processed transcript psmc6-202 834
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
psmc6-202 Contained in:

OTHER psmc6-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000058031 (1)
  • Ensembl_Trans:ENSDART00000152444 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CO933986 (1) 848bp
    CITATIONS (2)