Transcript

wnt3-201

ID
ZDB-TSCRIPT-120702-323
Name
wnt3-201
Previous Names
  • wnt3-002
  • ottdart00000055996
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000055996 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000055996|OTTDARG00000035654|ZDB-GENE-081003-1 wnt3|OTTDARP00000043921 wnt3-001 LG_none CR388157.38,FQ311889.3,CU570973.4 Danio rerio protein_coding KNOWN, 1498 bp
CTGATGATCCTAAGGGGAAAAAAGTGGGGAGAGAAAAAGA
TATGTACCTTAGGGAAGAACCTCAGTAAGAGGGAGGGAAT
CAGAGGACGAGTAGGAGCGTGTGTGCGAGTGTGTGAAAGA
GACACTTACTCTCCTAACTACTACTGGAAGACACACACTT
TTCTCACCCAACTCAAAGCAGCAGCAAACCTTGGAGAATT
GTTTTATTTTTGTTTTTTCGCGAACCCCCCCAAAAAAAAT
TCCTAATTATTCTCTCAAGCATCCATCTTTGCCTTGCCGG
GATTTAATTTTCACCCCCTCTCTAGGAATCCTATGTACTG
ATCAATAGACCCTTTCCATCCACACAAGACATACCTCATG
GATTTGTACCTGGTTGGATTTCTCATGTGCATGTGGTTCT
CCAGCTCTCGGGTGCTTGGAGGCTATCCCATCTGGTGGTC
CCTGGCCCTTGGGCAGCAGTACTCATCCATTGGATCCCAA
CCCATCCTGTGTGGCTCCATACCTGGCCTGGTGCCAAAAC
AGCTGCGCTTCTGCCGCAATTACATAGAGATCATGCCCAG
TGTAGCGGAAGGAGTCAAACTGGGTATCCAGGAGTGTCAG
CACCAGTTCCGTGGTCGCAGGTGGAACTGCACCACTATCA
AGGACAGTCTAGCAATATTTGGACCAGTGCTTGATAAAGC
TACAAGGGAATCTGCATTTGTTCATGCGATTGCCTCAGCT
GGAGTAGCATTTGCAGTAACCCGTTCATGTGCAGAGGGGA
CCTCCACTATGTGTGGCTGTGACTCCCATCATAAAGGCCC
ACCGGGAGAAGGATGGAAGTGGGGTGGCTGCAGTGAAGAT
GCTGAATTTGGGGTTTTGGTATCTCGAGAGTTTGCAGACG
CTCGTGAGAACCGGCCAGATGCTCGGAGTGCCATGAACAG
GCACAACAATGAGGCAGGACGAATGACCATATTGGAGAAC
ATGCACCTGCGCTGTAAATGCCATGGGCTGTCAGGCAGCT
GTGAAGTGAAGACGTGCTGGTGGGCGCAGCCTGACTTCAG
ACTGTTGGGGGACTACCTGAAAGACAAGTACGACAGCGCC
TCTGAGATGGTGGTGGAGAAACACCGGGAGTCCAGAGGCT
GGGTGGAAACACTACGAGCCAAATACGCCTTCTTCAAGCA
TCCCACTGAGCGAGACCTGGTATACTATGAGGGATCACCC
AACTTCTGCGAGCCAAACCCAGAGACGGGCTCATTCGGCA
CCCGTGACCGTGCCTGCAACGTGTCGTCGCACGGCATCGA
AGGCTGTGACCTGCTGTGCTGTGGCCGTGGCCATAACACA
CGGACAGAAAAGCGCAAAGAGAAATGCCACTGCATCTTCC
ACTGGTGCTGTTACGTTAGCTGCCAGGAATGTGTGAGGGT
CTACGACGTACATACATGTAAATAAGCACAGCGGGTCCAG
AAAGAAAGGGACTAGTGGACATTAAGCAAGAGAATGAGAG
ACTGAGGAAAAAAAAACA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations