Transcript

bida-002

ID
ZDB-TSCRIPT-120702-227
Name
bida-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000056189 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000056189|OTTDARG00000013716|ZDB-GENE-050419-35 bida|no_translation bida-002 LG_ BX470166.11 Danio rerio protein_coding KNOWN, 919 bp
GTTTATTGCGTTGCGTGTTGATTATGCTTCCCTGTTTGTA
TTCAAAGTTTACAGCACCTGTATGAGACATTGTACAGGCC
TGCTCGATGGACTTCAACAGGAACTTTGACCATATTCCAC
ATACATCTCTGGTGCTCCTTTCCTTTCTTGACCAGAAAGA
CTGCCAAAATGGTGAATCGGGAAGGGTCTTTGATTATCGT
GAAGATAACCTGTCTACAAATCATATTGACAGTGATGGGG
ATATAGAAACCGACGGACAAAGTCCACCAGCGACCTACAG
AGACCTTTTACATGAACTACAGCATGAAGTTCAGCCTGGT
CTTTCAGTCAATGCAGAAGAGGCTCGAGCTGCGAGAGAAA
TGGCGGCAGAGTTGATCAGAATAGCAGATCTTCTGGAGCA
GAGCGTTCTGTCTCAAGCTGCTGAGAGTCTGACTAAAAAA
CTGAGATCTTCCCAAGAACAGGTCTGTCAGATTGCTAAAC
TGTACGCATTTCTGATGGCTTTACGCGAATGGTTCCTCCA
TTTAAATAGTATCACTTGCATATTTTCAGGTTTGGGCCAG
TCATCTATCTAAAGGAGTGCAGACGTTACTTCAGCATGTG
GCAGCAGCCAAAGAGTTTAAGAAGGAGCTTGTGGAGATGG
CCTTCACGTTCATGCTCATGAAGACTGTTTGTGAACGCAC
ACCTGATTTTCTGTTTGGCCTTTATGGGACAGTGGTGCAG
TTTTTCGGATCCAACTGATCCCCGATGAAATCTGATGAGC
AGTTAGAGAAGTGAAGGATTTGAAGAAAAAAAGATACGTT
CAAACATGGTTTGATAATACAAATGTCAATTAATTCAGCT
TTTTAAAACTGAATACGTTTGATTTTGTAGCTGTTATTCA
TTGTGTTTGTTGTTGTTGTTCTCCATGACATTGGGTTTT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations