header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120702-227
Transcript Name: bida-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000056189 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000056189|OTTDARG00000013716|ZDB-GENE-050419-35 bida|no_translation bida-002 LG_ BX470166.11 Danio rerio protein_coding KNOWN, 919 bp
GTTTATTGCGTTGCGTGTTGATTATGCTTCCCTGTTTGTA
TTCAAAGTTTACAGCACCTGTATGAGACATTGTACAGGCC
TGCTCGATGGACTTCAACAGGAACTTTGACCATATTCCAC
ATACATCTCTGGTGCTCCTTTCCTTTCTTGACCAGAAAGA
CTGCCAAAATGGTGAATCGGGAAGGGTCTTTGATTATCGT
GAAGATAACCTGTCTACAAATCATATTGACAGTGATGGGG
ATATAGAAACCGACGGACAAAGTCCACCAGCGACCTACAG
AGACCTTTTACATGAACTACAGCATGAAGTTCAGCCTGGT
CTTTCAGTCAATGCAGAAGAGGCTCGAGCTGCGAGAGAAA
TGGCGGCAGAGTTGATCAGAATAGCAGATCTTCTGGAGCA
GAGCGTTCTGTCTCAAGCTGCTGAGAGTCTGACTAAAAAA
CTGAGATCTTCCCAAGAACAGGTCTGTCAGATTGCTAAAC
TGTACGCATTTCTGATGGCTTTACGCGAATGGTTCCTCCA
TTTAAATAGTATCACTTGCATATTTTCAGGTTTGGGCCAG
TCATCTATCTAAAGGAGTGCAGACGTTACTTCAGCATGTG
GCAGCAGCCAAAGAGTTTAAGAAGGAGCTTGTGGAGATGG
CCTTCACGTTCATGCTCATGAAGACTGTTTGTGAACGCAC
ACCTGATTTTCTGTTTGGCCTTTATGGGACAGTGGTGCAG
TTTTTCGGATCCAACTGATCCCCGATGAAATCTGATGAGC
AGTTAGAGAAGTGAAGGATTTGAAGAAAAAAAGATACGTT
CAAACATGGTTTGATAATACAAATGTCAATTAATTCAGCT
TTTTAAAACTGAATACGTTTGATTTTGTAGCTGTTATTCA
TTGTGTTTGTTGTTGTTGTTCTCCATGACATTGGGTTTT

bida TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA bida-201 (1)    Ensembl 917
ncRNA bida-002 919
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bida-002 Contained in:

Genome Resources: Vega_Trans:OTTDART00000056189 (1),  Ensembl_Trans:ENSDART00000151963 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH505666 (1) 950 bp
CITATIONS (2)