ZFIN ID: ZDB-TSCRIPT-090929-3393
Transcript Name: bida-201
Previous Name: bida-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016326 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016326|OTTDARG00000013716|ZDB-GENE-050419-35 bida|OTTDARP00000013841 bida-001 LG_ BX470166.11 Danio rerio protein_coding KNOWN, 917 bp
ACTAGACTCCCCGCTGCACTTGGCTTGTTGTTTATTGCGT
TGCGTGTTGATTATGCTTCCCTGTTTGTATTCAAAGTTTA
CAGCACCTGTATGAGACATTGTACAGGCCTGCTCGATGGA
CTTCAACAGGAACTTTGACCATATTCCACATACATCTCTG
GTGCTCCTTTCCTTTCTTGACCAGAAAGACTGCCAAAATG
GTGAATCGGGAAGGGTCTTTGATTATCGTGAAGATAACCT
GTCTACAAATCATATTGACAGTGATGGGGATATAGAAACC
GACGGACAAAGTCCACCAGCGACCTACAGAGACCTTTTAC
ATGAACTACAGCATGAAGTTCAGCCTGGTCTTTCAGTCAA
TGCAGAAGAGGCTCGAGCTGCGAGAGAAATGGCGGCAGAG
TTGATCAGAATAGCAGATCTTCTGGAGCAGAGCGTTCTGT
CTCAAGCTGCTGAGAGTCTGACTAAAAAACTGAGATCTTC
CCAAGAACAGGTTTGGGCCAGTCATCTATCTAAAGGAGTG
CAGACGTTACTTCAGCATGTGGCAGCAGCCAAAGAGTTTA
AGAAGGAGCTTGTGGAGATGGCCTTCACGTTCATGCTCAT
GAAGACTGTTTGTGAACGCACACCTGATTTTCTGTTTGGC
CTTTATGGGACAGTGGTGCAGTTTTTCGGATCCAACTGAT
CCCCGATGAAATCTGATGAGCAGTTAGAGAAGTGAAGGAT
TTGAAGAAAAAAAGATACGTTCAAACATGGTTTGATAATA
CAAATGTCAATTAATTCAGCTTTTTAAAACTGAATACGTT
TGATTTTGTAGCTGTTATTCATTGTGTTTGTTGTTGTTGT
TCTCCATGACATTGGGTTTTTTGTTCATTGTGTATATAAA
TAAATAAATGTAAGAAAACATGTCTGCTTTATTCATC

bida TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA bida-201 917
ncRNA bida-002 (1)    Ensembl 919
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
bida-201 Contained in:
[BAC] CH211-238N5 (1)

Genome Resources: Vega_Trans:OTTDART00000016326 (1),  Ensembl_Trans:ENSDART00000100716 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:EH503658 (1) 932 bp
GenBank:EH499648 (1) 914 bp
GenBank:EH560547 (1) 881 bp
GenBank:DQ860155 (1) 796 bp
GenBank:BC162699 (1) 653 bp
GenBank:BM036570 (1) 505 bp
GenBank:AL924614 (1) 487 bp
GenBank:BM036347 (1) 279 bp
CITATIONS (2)