ZFIN ID: ZDB-TSCRIPT-120213-969
Transcript Name: fam210aa-202
Previous Names: ch211-105d11.2-002, fam210aa-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053623 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053623|OTTDARG00000015883|ZDB-GENE-030131-5627 si:ch211-105d11.2|OTTDARP00000042172 CH211-105D11.2-002 LG_ AL928820.8 Danio rerio protein_coding KNOWN, 903 bp
AATTGATTTTAGGAAGTCGGTCCATGTTGTATTATTTATA
AGTGGTCTTCTGAGAATGTGCAGCTTATATATTTCTGTCA
TTTTTCAGCTGTTTAACCAAGACCAGTGACGTCCTTATTG
ATGGCATATTGAAGACGTTTGGGGGAAGAACCTGCTTTTG
TGATGCAGCGGTTTGTGTGTTCTGGAGTCTTCAGGCAGAC
GTCTGTCCTGCTGCAGATCAGCCCTGTGTCCCATTGCCAT
ACCAGACGGATGCAGGATTCCCCGTCCCATCGCAGCCTGA
AACAGCTGATTTCCAGCCAGCGATGGCTCAACTCCACCAC
CGCCCTCTGCTCTCCGACCTCACAGAAAACCTCTGCTTCA
GGACAGGAAGAGCCAGACCCACTGCATGACAAATCCAGTG
GCCTCATTCAGAGATTCAAGAAAACCTTTAAGCAGTACGG
CAAAGTCATGATCCCTGTGCACCTGCTGACCTCTACCATG
TGGTTCGGCACCTTCTACTATGCTGCAATGAAAGGAGTGA
ATTTGGTGCCGTTTCTCGAGTACGTTGGGTTTCCTGACAA
GGTAGTGAAGCTCCTGGAGAACTCTCAGAGCGGCTACGCA
CTGACAGCATATGCTATGTACAAGATCGCCACTCCAGCGA
GGTACACGGTGACTCTAGGAGGAACATCCTTGTCTGTGAA
GTACCTGAGGAAACACGGCTACATGTCCACTCCACCACCC
GTCAAAGAATACCTGCAGGAGAAGATGGAGGAGACCAAAG
AGAGGATCTCTGGCAAGATGGAGGAAACCAAGGATCGTTT
CTCCGAAAGAATGGAGGAAACGAAAGACAAGTTTAATGAA
AAACTTCAAGAAACCAAAGACAAAGTGTCTTTTAGAAAGA
AAAAAGAATAGATTTGGACACTG

fam210aa TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fam210aa-201 (1)    Ensembl 2654
fam210aa-202 903
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fam210aa-202 Contained in:
[BAC] CH211-105D11 (1)

Genome Resources: Vega_Trans:OTTDART00000053623 (1),  Ensembl_Trans:ENSDART00000151184 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH432420 (1) 910 nt
CITATIONS (2)