Transcript

fam210aa-202

ID
ZDB-TSCRIPT-120213-969
Name
fam210aa-202
Previous Names
  • ch211-105d11.2-002
  • fam210aa-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053623 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053623|OTTDARG00000015883|ZDB-GENE-030131-5627 si:ch211-105d11.2|OTTDARP00000042172 CH211-105D11.2-002 LG_ AL928820.8 Danio rerio protein_coding KNOWN, 903 bp
AATTGATTTTAGGAAGTCGGTCCATGTTGTATTATTTATA
AGTGGTCTTCTGAGAATGTGCAGCTTATATATTTCTGTCA
TTTTTCAGCTGTTTAACCAAGACCAGTGACGTCCTTATTG
ATGGCATATTGAAGACGTTTGGGGGAAGAACCTGCTTTTG
TGATGCAGCGGTTTGTGTGTTCTGGAGTCTTCAGGCAGAC
GTCTGTCCTGCTGCAGATCAGCCCTGTGTCCCATTGCCAT
ACCAGACGGATGCAGGATTCCCCGTCCCATCGCAGCCTGA
AACAGCTGATTTCCAGCCAGCGATGGCTCAACTCCACCAC
CGCCCTCTGCTCTCCGACCTCACAGAAAACCTCTGCTTCA
GGACAGGAAGAGCCAGACCCACTGCATGACAAATCCAGTG
GCCTCATTCAGAGATTCAAGAAAACCTTTAAGCAGTACGG
CAAAGTCATGATCCCTGTGCACCTGCTGACCTCTACCATG
TGGTTCGGCACCTTCTACTATGCTGCAATGAAAGGAGTGA
ATTTGGTGCCGTTTCTCGAGTACGTTGGGTTTCCTGACAA
GGTAGTGAAGCTCCTGGAGAACTCTCAGAGCGGCTACGCA
CTGACAGCATATGCTATGTACAAGATCGCCACTCCAGCGA
GGTACACGGTGACTCTAGGAGGAACATCCTTGTCTGTGAA
GTACCTGAGGAAACACGGCTACATGTCCACTCCACCACCC
GTCAAAGAATACCTGCAGGAGAAGATGGAGGAGACCAAAG
AGAGGATCTCTGGCAAGATGGAGGAAACCAAGGATCGTTT
CTCCGAAAGAATGGAGGAAACGAAAGACAAGTTTAATGAA
AAACTTCAAGAAACCAAAGACAAAGTGTCTTTTAGAAAGA
AAAAAGAATAGATTTGGACACTG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations