ZFIN ID: ZDB-TSCRIPT-090929-4290
Transcript Name: fam210aa-201
Previous Name: fam210aa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000019037 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000019037|OTTDARG00000015883|ZDB-GENE-030131-5627 si:ch211-105d11.2|OTTDARP00000016076 CH211-105D11.2-001 LG_ AL928820.8 Danio rerio protein_coding KNOWN, 2654 bp
AGTCACCATGTGTCATGTCGCTGCGTCTGCTGAGGAATTC
TCTGAATGACAGAAGGGACATGAATAAAATGTGTTTATGT
TGGCGAAATCACATCATGTTGGATCTCAGCTCTCACCTGT
TTAACCAAGACCAGTGACGTCCTTATTGATGGCATATTGA
AGACGTTTGGGGGAAGAACCTGCTTTTGTGATGCAGCGGT
TTGTGTGTTCTGGAGTCTTCAGGCAGACGTCTGTCCTGCT
GCAGATCAGCCCTGTGTCCCATTGCCATACCAGACGGATG
CAGGATTCCCCGTCCCATCGCAGCCTGAAACAGCTGATTT
CCAGCCAGCGATGGCTCAACTCCACCACCGCCCTCTGCTC
TCCGACCTCACAGAAAACCTCTGCTTCAGGACAGGAAGAG
CCAGACCCACTGCATGACAAATCCAGTGGCCTCATTCAGA
GATTCAAGAAAACCTTTAAGCAGTACGGCAAAGTCATGAT
CCCTGTGCACCTGCTGACCTCTACCATGTGGTTCGGCACC
TTCTACTATGCTGCAATGAAAGGAGTGAATTTGGTGCCGT
TTCTCGAGTACGTTGGGTTTCCTGACAAGGTAGTGAAGCT
CCTGGAGAACTCTCAGAGCGGCTACGCACTGACAGCATAT
GCTATGTACAAGATCGCCACTCCAGCGAGGTACACGGTGA
CTCTAGGAGGAACATCCTTGTCTGTGAAGTACCTGAGGAA
ACACGGCTACATGTCCACTCCACCACCCGTCAAAGAATAC
CTGCAGGAGAAGATGGAGGAGACCAAAGAGAGGATCTCTG
GCAAGATGGAGGAAACCAAGGATCGTTTCTCCGAAAGAAT
GGAGGAAACGAAAGACAAGTTTAATGAAAAACTTCAAGAA
ACCAAAGACAAAGTGTCTTTTAGAAAGAAAAAAGAATAGA
TTTGGACACTGGTGAAAGGGCTTGAAGTGACTTTGTCTCC
CATAATGTCTTGAAGATTCACATCGTTACACAATATAAAA
CAATTTATGAAGCACTTTGTCTTAAACATATATTAAACTA
ATGTAGGCTGCAAGCTCTACACTTATTGTTTATGTTTAAT
GCTAGCTATCACAGGATGGTGAAATTATAACTCCTAAAGT
TACAGTAGTTACTAAATACATAATATGACAGCACACACAA
AGTTTGCTGAAAAATGTTGGACTGGACTTGACTGAAGTAC
GTTTTTAACACATGAGAGTATTTTCTAAAGTGATTTGCCC
AAATATTATGAGTGACTTTGTTCATTAAAATATTATAAGA
TTAGTCTTGGCCAAAATGAAAATTCAAGTCACTCTGAAGT
CAAAAGAAATGTTCATCCAGAAGATCATGAAGATTGTTTA
CTGCTGTCTGTGCTGCCTTTGATTGTACGCTCACCCAAAA
TTCTGACTCTTCAAAAATATTTTAAGAAATCAGAAACTTT
TGGAAAGAACATACTGTACATAAAAAAGCTCAACCTAACA
TGCTTGACATGCTAGAAAAAAAATATTATCAATTTGTGCA
TGTTCAATGCTTCCAATTTCTACCATATTTGATTTCTGAT
GAATGCGTTAAAGAAAAAAGCATATATTTAATCCTTTATG
AAATGATTGGGTCAATTTGGAACACTTAAAGTGACAGTTC
ACCCAAAAATGAAACTTCTGAAAAACAAATACTTTTGGAA
GTCAATACAGGTTTCCAACATTCTTCAAAATATCTTCTTT
TATGTTTAGCAGATCAAAATGACAAAAAGGAAAAAAAAAA
CTCAAACTGGTTTGGGAGAAGGTAAAGTAAATGATGGCAG
AGTTTTCATTTTGGCTGTCTCTTTAAGGAATAAACCGTTT
TAACACTGATAGCTTTTTGGTATCTTGAACATTTCGGGGA
TTTGGATGACACTGAGGACAGAATTAAGATTTTGGACTGA
ACTAACAATAACAACATAGCACTGCCTCTTTTAGTTTTTG
CATGTTACATTATTATTTAAATTATTTATGGATTTGAAAC
AACCCAGACATTTTTATAAAAATTACTGAAAAGGATATAG
TCAAGGAAATCTTTAACCGTTTGTTAGTCTAGGTCTTGAA
AACTGTGTCAGACAGGTATAAATGTACAGTGAGATTTAGT
AGAGATTTGACCATTGTTTAAAATACTGGTAATGCTGAAT
ATGCACTAATATTTCTGACATATCATCAATGGCCTTTACG
TCCTGTTTGGAGTTCACGTTCAGTATGTTCCTGCCATGTT
CATGCGTTTTATTTATGTGACCTGATTTTTCATTTTTCTG
TGGACTGTGATGATGGCCAAGTCCCTTTTGTTTCAAGTGT
GCAAAGTAATTAATGAAGGTTATTAATTTAATCAATTATT
CAATGGAAAATATCTCTGCTGGTGAAGCACTTGAGATGTT
TAGCTCTTACAGGATTACGAGGCCTTTTATTTTGAAGGAT
GATCCACCTGACTGTCAACTTTGACAATAAAAACGATGAA
CATTTCTGGTGTCTTATTACAGATGTTTTTTTTATTAACC
TTGTAACATATTTGGGTCAAGTTTTGCAATGTAAAACGGT
GTTTAGTTGTCCTTAAAATGTCCAGCATGTTGTGAAGAAA
AAATAGATTTATAATTTTAAGTAAACTTGATAAAACTATA
TGAAGATAAATCAA

fam210aa TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA fam210aa-201 2654
fam210aa-202 (1)    Ensembl 903
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fam210aa-201 Contained in:
[BAC] CH211-105D11 (1)

Genome Resources: Vega_Trans:OTTDART00000019037 (1),  Ensembl_Trans:ENSDART00000103692 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133959 (1) 1764 nt
GenBank:EH441710 (1) 983 nt
GenBank:EE307457 (1) 836 nt
CITATIONS (2)