Transcript

rcvrn3-203

ID
ZDB-TSCRIPT-120213-945
Name
rcvrn3-203
Previous Names
  • rcvrn3-003
  • ch211-232m10.5-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000053511 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000053511|OTTDARG00000017049|ZDB-GENE-040426-1661 zgc:73075|OTTDARP00000042086 CH211-232M10.5-003 LG_ BX950195.14 Danio rerio protein_coding KNOWN, 965 bp
GGATCATTACTCAGACACACTCTTCCTTCATTACTTGCCC
CTTCATTCTTCATCCTTGGATCACTAGCACAGACAGAAGT
CATGGGAAACGCACAGAGCGGAGGGATTCCCAGAGAAATC
CTGGATGACCTGAAGCTCACCACCAGGTTCTCCGAATCTG
AGATCACCCAGTGGTATGAGAACTTCCAGAAGCAGTGTCC
TACAGGTCGCATCACACTGCAGCAGTTCGAGGAGATCTAC
GGTAAATTCTTCCCTGACAGCGATGCCACCACTTACGCCC
AACACGTTTTCCGCTCCTTTGATGCCAATGACGATGGAAC
GTTAGACTTTAAGGAGTACGTTGTGGCTCTTCACATGACC
TCCTCGGGCAAGTCCACCCTAAAGCTGGAGTGGGCCTTCT
CACTGTTTGATGTGGACAAGAACGGTTACGTCACAAAACC
TGAAGTGATTGAACTCAGCCAGGCCATTTTCAAACTCATC
CCCAAAGACAAGCAGACAAGTCTTCCCAACGATGAGAGCA
CGCCAGAGAAAAGAGCAGAGAAACTCTGGGCCATCTTTGA
CAAAAAGGACAACGAACGAGTGGCAGAGGGGGAGTTCATT
GAAGCCATCCAGTCAAGCGATGATGGTCTACGGCTCATTC
AGTATGATCATAAATGAGCCAGCATAATCATTATCCTATA
ACGCGAGTTTTTTTTTTTCATGCTTGAATGTATGTGTATT
TGTTGCTTATTAAATGTGTTAAAGGTTCACCATCATAAAG
GTGCTGTCTGTACAGTTTTGACTCTTCTAATTCATAAAAA
ATACCACAATATGTTAGCAGATATAAGGAATATAATAAAT
TAACATACTACTTTATCTGAAAAACAATGCTATAGTCAGT
TATTCTCCTTTGAAAATGTACATTCTGTATTGCTATGTCT
GTCTTTGTTTTGGTCTGTGTAACTCCACCCACTGCCAGTT
TACCT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations