Transcript

rcvrn3-201

ID
ZDB-TSCRIPT-090929-4789
Name
rcvrn3-201
Previous Names
  • rcvrn3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000020545 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000020545|OTTDARG00000017049|ZDB-GENE-040426-1661 zgc:73075|OTTDARP00000017354 CH211-232M10.5-001 LG_ BX950195.14 Danio rerio protein_coding KNOWN, 3507 bp
TCACTCAGACAGAAGTCATGGGAAACGCACAGAGCGGAGG
GATTCCCAGAGAAATCCTGGATGACCTGAAGCTCACCACC
AGGTTCTCCGAATCTGAGATCACCCAGTGGTATGAGAACT
TCCAGAAGCAGTGTCCTACAGGTCGCATCACACTGCAGCA
GTTCGAGGAGATCTACGGTAAATTCTTCCCTGACAGCGAT
GCCACCACTTACGCCCAACACGTTTTCCGCTCCTTTGATG
CCAATGACGATGGAACGTTAGACTTTAAGGAGTACGTTGT
GGCTCTTCACATGACCTCCTCGGGCAAGTCCACCCTAAAG
CTGGAGTGGGCCTTCTCACTGTTTGATGTGGACAAGAACG
GTTACGTCACAAAACCTGAAGTGATTGAACTCAGCCAGGC
CATTTTCAAACTCATCCCCAAAGACAAGCAGACAAGTCTT
CCCAACGATGAGAGCACGCCAGAGAAAAGAGCAGAGAAAC
TCTGGGCCATCTTTGACAAAAAGGACAACGAACGAGTGGC
AGAGGGGGAGTTCATTGAAGCCATCCAGTCAAGCGATGAT
GGTCTACGGCTCATTCAGTATGATCATAAATGAGCCAGCA
TAATCATTATCCTATAACGCGAGTTTTTTTTTTTCATGCT
TGAATGTATGTGTATTTGTTGCTTATTAAATGTGTTAAAG
GTTCACCATCATAAAGGTGCTGTCTGTACAGTTTTGACTC
TTCTAATTCATAAAAAATACCACAATATGTTAGCAGATAT
AAGGAATATAATAAATTAACATACTACTTTATCTGAAAAA
CAATGCTATAGTCAGTTATTCTCCTTTGAAAATGTACATT
CTGTATTGCTATGTCTGTCTTTGTTTTGGTCTGTGTAACT
CCACCCACTGCCAGTTTACCTAATTCTATTTTGGCACTCC
AGGTTGCCATGTTGGGAAAAAACCCTCCCCACTCCAAGTG
TATCTGTGGACTGCAATAGAGGGGCGTAACATGAAGGGGG
CGTGACTTACAGTTGTAAGTTAGAGGCGTAACATGCAGTT
ATCAAGATCCCTTTGACCCATGGCAGATGTCAATGAGATG
TTGTTAGCAAGATGGTGGAAATACTTTCCGAAGAACATTT
TCAGCAAATGTTTTCATATTCTCCACATTTATTCATAACA
TATTCATTTGCTATATTATTATTTTCATTCGTTCATTAAG
CAACTGTACTCACTGACTTCCACTGTTGCCAACTATTTTC
AACAAAAAGGCACTTAGCTGTGCCTGAAAAGTCGCTAAAA
GTTGCTAGATTACATCATACATTAATTTGCATATTACTGA
CGTCATCACGTTCTACCATTTCTGTTTGTTTAACAGCCTA
CGGTCAATAAAGGGGTATTTATATTTGCACTACACTTTGT
GTAAGCATGTCAATTTAACTAAATTTATTGCTGTTTGGAT
ACAGCATATCATAGATGTGTGGTGAATTTGCAGTAATCTC
TCAGGCGTAATAAACTCAGACAAGTTCTGAAATTGTCACT
TAAATCTCTTTGATTGTGAACAATAAAAGAATAACCGGTC
AAGTTATATTGTTAAAATAAAGAAGAAGCAGATCGGTTTG
ACTGTACAAGAGAAATACCTTAACACTTCCGGTGCTAAAT
CATTTGCCGTCAGTACGCAGAGGGGGGATCTGCAGGTGGG
AGAGGCTGCTGTACGAAGACTGGGCCGCCTGTCAGTGCTC
AGAGCCGGGGGAGGGGCTGATGGCATCACCTGCAGCTCGT
TAAGAAGGGTAACGCCCCATTCACACGGGGCTTCAGCGCC
AACGCTTCCTATTTACTTTGAATGGGTGATGTCAGGCGTT
GCCGAACTGCATTGTGGATCCATCGGCACCACTTCAGAGG
CGTTGCTCGGCGCAGAAGTTGGGACTAGTTCAACTTTTCA
AGCGTTGACGGAAGCGTCAGCCAATCAGATTGCTGAATGC
AAATACACCAGTTAGACAGTGGCCTATTGCTGACAGAATT
TCATTGGCTGATGCTGCTATGACGATCGCGGCAACCTTAA
CTTCAGACATGCCTTCAGTCAAGCGTTGACCCTGAAGCCC
CTGTGAATGGGGTGTAAGGACGGAAATGACAGCCTATAAA
AATCTCCAGTAACACACAAAAAAGTCACCAGATTTGTCGC
TAGTAGCTTTTTTGAAAATTTGTCGCTAAGGGGGGGTCTG
AAAAGTCGCTAAATATAGTGACTAAGTCGCTAAGTTGGCA
ACATTGCTGACTTCTTCACCTGTTTTGGCATGACAGTTAA
CCTACTCAACGTTGCCCTCCTGTGGTTGTAAATAACAGTA
CAATGACCCCATGTATAATGATAGAAATTAGGTCTGAACC
TGTCGGATCCCATCGGGTTTCTTCAGGTTTGGGCAAACAT
CTTCAGCTCTAATATAGACGTTAACAACTGTGATGGTTGG
GTTCAGGGTTGTGGAAGGTTTAGACACCATTAACTGTGAT
GGTTGGGTTTAAGTGTCGACGTTAATAACTGATGTACAGT
GTCATATTGCCGACAACATAGCTTTTACATGTGGGTCTCC
GTAACTTGAAGTTACGCCTCTAACATACTACAAGTTACAC
CTCTTCATGTTACGCCCCTGTCTTGCAGTCCGCAGACAGA
CCCTACACTGAATTTGGACTGCAATACCTAGTTCAACCAC
AAGATGTCAATCCTACATACTGCACCTTTAAATTTGAGTG
CCGCCATTTTATAAGCAATATGTTAATTTTGTTTTTGTGT
CATGAACATATTTGACTTTTTGTCATGCGTTTTGTTGTGA
TTTAGAGCTTTATATGCTTTTCACCTTGTTTAAAGTCTAC
TTTTATTTTGATAGTCTTAAAGTGAACAATCGTTCTATGG
AAGTTGATACTTAAAAACATTTGTTTAGGTAATCTTTGAT
CCAAATCTGGTGACGGGTTGGGTGAAATACACCTACACCC
CTCAAGTTGTTAATTTATTGCAACTGAAAGATGAGAGGAG
GAGCAAAAAATAAGACCCCGCCCCCTACTGAATATTAAAA
CGTCATCCTACTGTCATTAAAGTCTGCAGCAAACTATAGT
TTCATGCAGATTTTAATCGCATACCTTATATGATCATTCG
TAATTAGTTTTGGATTATAGTTTGTAGGTTCATGTTCAGT
TGATGTGCTGTTGATTAGTCTCACAAATGGGTTTTGATGG
AAATAGTCATGTTAAATTTGTTTGATAATTCTCAATGTGT
TGTTGATTTCATTCAAACAAGATTTTTATGGTTTATTTTT
TGCACTACATTACATTTGTTTCTAACAGTATTATTTCCTT
ACAGTTGTGTAAATATTACACAATCAAAAGTAATTTGAAT
GATTATATTTTTTGTTATTTCTTGATTTGAATATTCAAGT
TTTGGCCTGGTTTTGAATATTTAAGAATTTGTGTGTGTCT
GCTTGTATTATAACTTGAACATGCTTCCTATCTTCACCAT
AAACAAGACTACGAAACATAAGAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations