header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-90
Transcript Name: krt91-003
Previous Names: dkeyp-113d7.8-003, zgc:92533-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053199 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053199|OTTDARG00000014148|ZDB-GENE-040801-181 krt91|no_translation DKEYP-113D7.8-003 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 630 bp
TGAGCTGAAGATCCGCCAGTTCCTGGACAGCAAGACATCT
CCCTCTGCTCGGGACTACAGTGCCTACTATGCAACAATCA
GTGACCTCCAGAACAAAATCCAGGATGCCACTCGTATCAA
TGGAGGCATCTACCTCAGCATTGACAATGCCAAGCTGGCC
GCAGATGACTTCAGGGTCAAGTAAGTCCATATACAGTACA
CTAAAAGAAAAGCTATCACCACGTCAAATGGGCCTGAGTA
ACAATGGTTTGATTTCTGCGCAGGTATGAGAATGAGCTGA
GCATGAGGCAGTCTGTGGAAGCAGACATCGCTGGCTTGAG
GAAGGTACTGGATGAGCTCACAATGACCAGATCTGACCTG
GAGATGCAGATCGAGGGTCTGAAGGAAGAACTGATCTTCC
TCAAGAAGAACCACGAGGAGGTAAATTAGTGATTGGATCA
CACTCTTTAATAACTATGATATTTCGCCCAATGAGGCAAC
TGCTCAGTGGTTTGCTATTGCACCTTTAGGAGCTCTTGGC
AGCACGTGGCCAGATGAGCGGACAAGTCCACGTAGAGGTC
GACGCAGCACCACAGGAAGACCTGACAAAGGTCATGGCTG
ATATCCGTGAGCACTACGAGCAAGTTGCTG

krt91 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA krt91-003 630
mRNA krt91-201 (1) 1582
aberrant processed transcript krt91-202 (1) 557
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt91-003 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER krt91-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053199 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN898768 (1) 630bp
    CITATIONS (1)