ZFIN ID: ZDB-TSCRIPT-120213-475
Transcript Name: krt91-202
Previous Names: krt91-002, dkeyp-113d7.8-002, zgc:92533-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053200 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053200|OTTDARG00000014148|ZDB-GENE-040801-181 krt91|OTTDARP00000041850 DKEYP-113D7.8-002 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 557 bp
CCTCCCCTCAACAAGCATGTCTTCATACAGCCGTAGCAGC
TTCAAGTCCTCTGGGGGCTCCATGAGTGGAGGATCTCGCT
TCTCCATGTCTGGTAGCGGTGGTGGAGGTGGACGTGTCTC
TGGCATGTATGCAGGCAGTGTGCACGGAGGAGCTGGAGGT
GCGCTCTCTGGAGAAGGCCAATGCAGATCTTGAGCTGAAG
ATCCGCCAGTTCCTGGACAGCAAGACATCTCCCTCTGCTC
GGGACTACAGTGCCTACTATGCAACAATCAGTGACCTCCA
GAACAAAATCCAGGATGCCACTCGTATCAATGGAGGCATC
TACCTCAGCATTGACAATGCCAAGCTGGCCGCAGATGACT
TCAGGGTCAAGTATGAGAATGAGCTGAGCATGAGGCAGTC
TGTGGAAGCAGACATCGCTGGCTTGAGGAAGGTACTGGAT
GAGCTCACAATGACCAGATCTGACCTGGAGATGCAGATCG
AGGGTCTGAAGGAAGAACTGATCTTCCTCAAGAAGAACCA
CGAGGAGGAGCTCTTGGCAGCACGTGGCCAGATGAGC

krt91 TRANSCRIPTS
Type Name Length (nt) Analysis
aberrant processed transcript krt91-202 557
mRNA krt91-201 (1)    Ensembl 1582
ncRNA krt91-003 (1)    Ensembl 630
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt91-202 Contained in:
[BAC] DKEYP-113D7 (1)

Genome Resources: Vega_Trans:OTTDART00000053200 (1),  Ensembl_Trans:ENSDART00000146890 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BE201057 (1) 557 nt
CITATIONS (2)