ZFIN ID: ZDB-TSCRIPT-120213-850
Transcript Name: ubl7b-004
Previous Name: ubl7-004

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053131 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053131|OTTDARG00000037279|ZDB-GENE-040426-1334 ubl7b|no_translation ubl7-004 LG_ CU896640.11 Danio rerio protein_coding KNOWN, 1289 bp
CTGTTGACAAAACGCTGCCTCACCGACTGCTGGATGAACA
AATCGGGATAAACCGAATATGGCGAGTTCAGCTTGGCATC
TCTCTCTGAAAGTCAGCGACAAACCCAAAGCACTGTTCCA
GTTTCCAGATCCTGAACCTGGAGATGTTCATCCAGGAGGA
TATCAGGTGTCCACGCTCAAGCAGCTGATCTCAGTGCAGT
TATCAGACTCTCTGCCCGACCCCGATCTCATCGATTTTGT
GCACTGCGGCTGTGTGCTGAAGGATGATCTCACACTAGAT
TCGTACGGCATCAAGTCTGGATCAACTCTGCATATCATCA
AGAAGACGTGGCCGGAGCCGGAGATCCAGCCTGAGCCCGT
CAACAGATCTGCAGCCGCCAGAGAGTTCAGGATGCTTCAG
GCCGCGATGCTCTCCAATGCAACATACAGAGAAGCGGTGT
TTAAGATGCTGGCCAATAAAGAGTCGCTGGACCAGATCAT
CGTGGCATCTCCAGGCCTCAGCTCAGACCCGGTCGCATTA
GCTGTGCTTCAGGATAAGGATCTGTTCGTTCAGTTCACAG
ACCCAAACCTGCTGGACACGTTGATCAGGTCTCACCCGTC
GCTGGTTAATGCCATTATATTAATCCTGCACTCAGTGACC
AGCAGCTCCGGTCAGTCCAGCAGCGGCTCCTCACGCAGCA
CAGCGGCCAGTTCATACAGCCAGATGCCCGGTAAACACTG
ACAAACATGCAGAAAACACAGAGTATGATCATAATTACAG
TGTCTGAACATTCGTGTGTGTTGACAGGAGGATTTCTGTT
TGATGGCATGTCAGACGATGAAGACGATTTTCAGTCGGCC
AGCCGTGGCGGCTCCTCGTGGCCCCTAAGAGCGTCTGGGT
CCAGACCGGGGACTCTTGCTCACAGCGGAGCCATGGGGCC
TCGACCAATCACACAAAGTGAACTCACACACGCTCTCGCT
TTAGCCAGCACACCTGAAGCCGGCGGCACTGCTCCAGCAC
AGGATGGGTCTGCGGCTGGAGCTCCGGTCAGCAGTGGTCT
CTTCAGCCACGCACTGCAGCAGGCACTACAGGCCTCTGGC
GTGAGCTCACTTCAGCAGGGCCGCTGGCAGCCGCAGATGC
AGCAGTTGAGGGATATGGGCATCCAGGATGAAGAAGTGGC
TCTGCGCGCTCTGACCGCCACTAATGGAGATCTGCAGGCC
GCGCTGGAGCTCATCTTTGCAGGAGGACTCTAGTCTGACA
CACTTTAATTTGACTCTTTTTTTACTTTTGTCCTAAATAA
AGCTTCATT

ubl7b TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ubl7b-201 (1)    Ensembl 1236
ubl7b-205 (1)    Ensembl 804
ncRNA ubl7b-002 (1)    Ensembl 850
ubl7b-003 (1)    Ensembl 892
ubl7b-004 1289
ubl7b-005 (1)    Ensembl 720
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ubl7b-004 Contained in:
[BAC] CH73-116F3 (1)

Genome Resources: Vega_Trans:OTTDART00000053131 (1),  Ensembl_Trans:ENSDART00000151374 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH612269 (1) 945 nt
GenBank:GO940114 (1) 810 nt
CITATIONS (2)