ZFIN ID: ZDB-TSCRIPT-120213-80
Transcript Name: ubl7b-003
Previous Name: ubl7-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053132 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053132|OTTDARG00000037279|ZDB-GENE-040426-1334 ubl7b|no_translation ubl7-003 LG_ CU896640.11 Danio rerio protein_coding KNOWN, 892 bp
ACAAAACGCTGCCTCACCGACTGCTGGATGAACAAATCGG
GATAAACCGAATATGGCGAGTTCAGCTTGGCATCTCTCTC
TGAAAGTCAGCGACAAACCCAAAGCACTGTTCCAGTTTCC
AGATCCTGAACCTGGAGATGTTCATCCAGGAGGATATCAG
GTGTCCACGCTCAAGCAGCTGATCTCAGTGCAGTTATCAG
ACTCTCTGCCCGACCCCGATCTCATCGATTTTGTGCACTG
CGGCTGTGTGCTGAAGGATGATCTCACACTAGATTCGTAC
GGCATCAAGTCTGGATCAACTCTGCATATCATCAAGAAGA
CGTGGCCGGAGCCGGAGATCCAGCCTGGTGTGTTTAGAGC
TCATTTCTGATGAGACATTCCTGAATTATATTCTGTCTGT
GATGTGTTTCTGCATCTTTTAGAGCCCGTCAACAGATCTG
CAGCCGCCAGAGAGTTCAGGATGCTTCAGGCCGCGATGCT
CTCCAATGCAACATACAGAGAAGCGGTACCAAAGACTCTA
GATAAAATACAAGACACGTCACTCCTGTAGTTTTCAGTGG
GCAAATGTGGTTGTTGCTAGAAGGGATACAGCTGTGGCCA
GAGGTTAACAAGAATTAATTATGCAATTTATAAAATTATA
CATTATATGTATTTTATAAACATCTCCCCCTACCCAAACC
CTCACAGTCATGTAAATACAGTAATTACGCAGAGTAATGT
TCATATTATTTATTAAATGAACAATTAAATCATATTTTAT
GATCATTTACCGCTATCCCAACCCTCACAGTAATGTAAAA
ATATTAGTTATTGTTGTAGAGCGGTGCTCTCAAACCGGGT
TCCTGCCTCAGTTCTGCACAGTTTTGCTCCAACCCTAATC
AAACACAGCCAA

ubl7b TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA ubl7b-002 (1) 850
ubl7b-003 892
ubl7b-004 (1) 1289
ubl7b-005 (1) 720
mRNA ubl7b-201 (1) 1236
ubl7b-205 (1) 804
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ubl7b-003 Contained in:
OTHER ubl7b-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053132 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CT654487 (1) 892bp
    CITATIONS (1)