Transcript

tcte1-202

ID
ZDB-TSCRIPT-120213-803
Name
tcte1-202
Previous Names
  • tcte1-002
  • ch73-91k6.4-002
  • si:ch73-91k6.4-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052875 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052875|OTTDARG00000037115|ZDB-GENE-120406-12 tcte1|OTTDARP00000041576 CH73-91K6.4-002 LG_ CU660013.12 Danio rerio protein_coding KNOWN, 870 bp
ACATTTAGAAGTCACTTAATTAATTAACGTTCAACGTTTT
CTTTAACTAAGATTCGTCTTTTATTTTGCGTTCATATACT
AAAAAGCTACATTTATTCGAGGACAAAGGTAAAAATGACG
TCGTGAAAGAAAGTCGTCCATACAGGCAGCAGTGATGAGT
ATGTCTCGGAGTCAGTCTTCTCAGAGATCCGGGGTCATGA
ACTCCGCTTCTGACGGCCAAAAAAGGCGCAGTATCATCGC
GGAGGATCATGAGTGGTCGCTGGCGCTGGTTCCTCTGCTA
ACAACACTCTGTTTACAGCATATTATAAAACACTTCGAAG
AGAAGCCCATTCTGCATGAGCTCCAACCCAGCTTTAAAAC
ATACGTCCTCCAACGACTGCCAGCATCTCTTCCGTTGACC
ATCACTGCAAACCTTATTAGCGATGAGAGCTACTGGAAAC
GCTGCTGTGAAGCTCGCTGGGGACTCGCTGACATCTCCAC
GTATGATAACAGCTGGAAACAAATGTTCTTCGAGCGTCAC
CTTCAGAGCATCATTGAACTCTTTATACCAGACACAACTG
ACACCAAAACAGTGCTAGATGTGCTGCCTTTGTGTCAAAA
CTATGTCAAGCAGCTGCGGGTTTCTCAGCTGCTGCCGCCC
ATTAAAGAGCCGTCCCGGTTTGACGAGGACGACGGGTCAG
AGTCTGCCAGTGATATGGGCAGTGATGGACCCTCCATGGA
CCACTTTGATTTCCGAATGCTGCTGGACAAGCTGCCGAAT
CTGAAAGAGCTGAGCGTGGTTTATTGCGTGAAAGGATGTG
GCATGAACTTTGAGTGGAATCTGTTCGAGTTCACCTTCAG
AGACTGCGAATCCCTGGCTAAAGCACTCAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations