Transcript

tcte1-203

ID
ZDB-TSCRIPT-120213-417
Name
tcte1-203
Previous Names
  • tcte1-001
  • ch73-91k6.4-001
  • si:ch73-91k6.4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000052874 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000052874|OTTDARG00000037115|ZDB-GENE-120406-12 tcte1|OTTDARP00000041575 CH73-91K6.4-001 LG_ CU660013.12 Danio rerio protein_coding KNOWN, 1572 bp
CATCAAACTTTCCCGAGGAACAGAAAGTGTGAGTCGACAT
TTAGAAGTCACTTAATTAATTAACGTTCAACGTTTTCTTT
AACTAAGATTCGTCTTTTATTTTGCGTTCATATACTAAAA
AGCTACATTTATTCGAGGACAAAGTTTTAGCAGTATGTCT
CGGAGTCAGTCTTCTCAGAGATCCGGGGTCATGAACTCCG
CTTCTGACGGCCAAAAAAGGCGCAGTATCATCGCGGAGGA
TCATGAGTGGTCGCTGGCGCTGGTTCCTCTGCTAACAACA
CTCTGTTTACAGCATATTATAAAACACTTCGAAGAGAAGC
CCATTCTGCATGAGCTCCAACCCAGCTTTAAAACATACGT
CCTCCAACGACTGCCAGCATCTCTTCCGTTGACCATCACT
GCAAACCTTATTAGCGATGAGAGCTACTGGAAACGCTGCT
GTGAAGCTCGCTGGGGACTCGCTGACATCTCCACGTATGA
TAACAGCTGGAAACAAATGTTCTTCGAGCGTCACCTTCAG
AGCATCATTGAACTCTTTATACCAGACACAACTGACACCA
AAACAGTGCTAGATGTGCTGCCTTTGTGTCAAAACTATGT
CAAGCAGCTGCGGGTTTCTCAGCTGCTGCCGCCCATTAAA
GAGCCGTCCCGGTTTGACGAGGACGACGGGTCAGAGTCTG
CCAGTGATATGGGCAGTGATGGACCCTCCATGGACCACTT
TGATTTCCGAATGCTGCTGGACAAGCTGCCGAATCTGAAA
GAGCTGAGCGTGGTTTATTGCGTGAAAGGATGTGGCATGA
ACTTTGAGTGGAATCTGTTCGAGTTCACCTTCAGAGACTG
CGAATCCCTGGCTAAAGCACTCAATTCCTGCAAGACTTTA
CAGGTCTTCAGGATCCATCGCAGTAAGGTGGACGATGAGA
AGTGTTGCGTGATCGTGAACCACCTGCTGGATCATCCGTC
CCTGCAGGAGCTGGACTTTTCACATAATCACATCAGTGAC
CGTGGAGCCCGAGCCATCGCGAAACTCCTGAACCGCAGTC
AGCTGAAGACACTGATCGTCTGCAACAACCAGATCAGAGG
TGCAGGAGCTCAGGCTCTGGCTCACGCTCTGGCCAAGAAC
AACACTCTGACGTCCCTCAACCTGAGACTTAACCGCATCG
CAGATGAAGGGGGACAGGCACTGGCTCAAGCTCTAATCAA
GAACAAGACTTTGGTGAATCTCCACCTCGGGGGAAATAAC
ATGACTGAACCCGCAGCCGTGGCTCTGTCTCAAGCCCTGG
TGGAGAACTGTGCCCTCAAGAGTCTAAACCTCTGCAACAA
CAGACTGGGAGCTGACGGAGGGAAGGTTCTTGAGGAGGGA
ATGACCCATAACTGCACTTTGGTGGAGTGTGACATCCGTC
TGACCGATGTGGATCAGGACAGTGAGTACAGCATCTGTCA
GGCTCTGCACGCCAATCAGATCAAAACCAAACACAACCAC
GATCCCAGTGCCAAAGTCTGAGCCATGCATACTGTACACG
CTATTATTAGTCACCGGAAAACTCTGCAAGCTAATAAAAA
TATTAAAATTAC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations