ZFIN ID: ZDB-TSCRIPT-120213-720
Transcript Name: baz2ba-203
Previous Names: baz2ba-002, ch73-209m22.1-002, zgc:165617-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054521 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054521|OTTDARG00000038073|ZDB-GENE-070615-37 baz2ba|OTTDARP00000042827 CH73-209M22.1-002 LG_none AL929243.7,FP236762.4 Danio rerio protein_coding KNOWN, 364 bp
GCGCAAAGTCACGTCTGCCAGCCTGCAGGTCAAGGGCTGG
ACATACCCAGAGCCGCAGTCTGAGAGAGAGGACCTTGTCT
ATTTCGAGCACAAGCCCCTCCCCAAGCACCGCCCTGGGGC
GGAGTCTCAGGAGGAGCGCAGCTCGGAGAAGGGTCTGATC
CGGCGCCCCAGCAACCCGCTGGACATCGCTGTGATGCGGC
TGGCAGAGCTGGAGCGCCACATCGAGAGAAGGGGAGAGGA
AGAGATTGCTCCAGGAATGAAGCTCTGGCGGAAAGCTTTG
AGTGAGGTGCGCAGCTCCTCTCAGCTGGCCATGTGTCTGC
AGCAGCTGCAGAAGTCCATCGCCTGGGAAAAGTCTATCAT
GAAA

baz2ba TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA baz2ba-202 (1)    Ensembl 6285
baz2ba-203 364
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
baz2ba-203 Contained in:
[BAC] CH73-209M22 (1), DKEYP-15G8 (1)

Genome Resources: Vega_Trans:OTTDART00000054521 (1),  Ensembl_Trans:ENSDART00000151075 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT701282 (1) 671 nt
CITATIONS (2)