ZFIN ID: ZDB-TSCRIPT-120213-335
Transcript Name: baz2ba-202
Previous Names: baz2ba-001, ch73-209m22.1-001, zgc:165617-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054520 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054520|OTTDARG00000038073|ZDB-GENE-070615-37 baz2ba|OTTDARP00000042826 CH73-209M22.1-001 LG_none AL929243.7,FP236762.4 Danio rerio protein_coding KNOWN, 6285 bp
AATTACTGCCCAATTCCCTTCTTCATCATCTCCTGCTACA
CCGGCCTCTTCCAAAAGCAAATCGAAAAAGGAAAACAAAG
AGAAACGTTACCTGAAGTGATACTTCGAAGCCGGAATTAC
GCGAAGTGTCAAAACTAAAGGTGGACAAGCAGTGATGTCA
CATAGCTGAGGACACTCCCACTCAATATGGAGTCTGGAGA
ACGGCTGGCCTCGCCTTCCGCCACCCCGGCCTCCGTCCAC
ACCGCCACCTCAGTGTCATCATCTTCCTCTTCCTCCTCTT
CCTCATCCACAGCAGCCTCCAATGCCAAGAGCAGCCTGAA
CCACGGAGCCACGGCCTCGCTCGGCACATGCGGTCCTCTG
TTTGGGTTGACTGGCAGTGACCAGCCTTTTAGTGTCAGCT
CAGTGACCTCTGTGCCCAGTGCTTACCCTCTCATGGCCCA
TCCAGCCTTCGGTCTGCTCTCACCAGCGACGGTCCGCCCA
GAGTTTGGAGGTTTAGGAGGATTGGGGGTCTCTGCTGCCC
TCGCAGCTCATCCTCAACTAGGAGCCTTCTCAGAATGGTG
GAGAGCAGCAGAAGCACATGGGCGGAGTCCTCCAACCTTC
TTCCCGCCTTTCCTGGGTCTGCCCCCAATATTTGCCCCGC
CCCTTCACAACCACGAGGCCAATCCGTACACATCCAAAAC
GCCTAGCAAGAGCAGCCAGGCCTCCAAAGGTGTGAACGGA
GCGGTGAATGGTCGTTCGCTGTCTCCCTCTGTGGCGAAAG
GAACGGTTTCGGCTTCTGCTTCCCCCTCCCCCGCGCTCCG
GCCCCCTGAACACAGCCGGACACTCAACGCCAAAGCCCGC
GACCGCAAGGCCAGTCACCATAGCAACAGCACAGGGGAGC
TTCAGGAGAAACCCTCGCAGAAAACTAAAGAGAAGAAATC
CCGTAAGAAGCAGGTAGAGGGGCCTGGCGTAAGTGAGAGT
GAATCTGGATCATCACTGGATACAGACAGCGACGGAGTGA
GCAGCAGTGATATGGATGATCTTGGAGAGGAGGATGATGA
TGACGAAGATGAAGATGAACAGAGTAAAGACAGCGAGGAG
TCGGACTCGGAAAAGGAGCGGCAGAAAAAAAAGAAAATGA
AAATCGTGACAGCAATTTCTGGGCTCAGTAAGAAGGAAAA
GTCCAAGCTGCTGGAAGCTCAGGACTTCCGTGGAGGTGCA
CCGTTAGATGCCACACCTCCATTGCACCTGCATCGCTCTC
CACCTCCACCAGCCCACTCTCAGTCCCCTCTGCTGTCTGT
ATCGGGCAGCAGAGCCAGAGAAAGACCCCTCCACACCAGC
GTCATCCAGTCCACCGGCCTGGCTGCAGCCAGTAAACCAT
TAGCACTGATCGCACAGTCGCGTCGAGACGCTTCTCCGAA
ACATTCTCCACAGCATCTGACCTCATCCTCTCCAAAAACC
CTCTCCGCCAAGCCACTCCCTTCATCACCTCAGCCCCTCC
CACTGTCGTTATGCTCCTCCCCTAAACCGCTGTCAGTACC
CTCCCCACCAAAACCCCTCCCACTGTCCTCTTCCCCCAAA
CCGCCACCTCTCACCCCTTCCCTCAAGGCACAAGCGTCCT
CGCGCAAGTCCCAGTCTCCAGCGCTGGACGCCCTGACCAG
CAGGAAGCTTCTGGAAAGTTCTCTGGCTCAAGTCACGGCT
GACTACAGGCTGAAACAGTCTTTTCTGCAGGACCAGCCGT
TTCCTCTTCAACTGAAGAAACAGCAGAACCCATTTAAGAG
CAACAAGAGGTCAGCGCCGCTCACATCATCATCTTCGTCC
ACCTCGTCCTCCTCTGTTCTCCCTCTTAAGCTCAGCTCGG
AAGTGTCAGGCAGGACCAAACCCCCCACAACCCAAAGCGT
GTCCTCCAGTCTGCCTTTCTCTCATGGCCTGTTGGGTCTA
AGTCAGCCCAACGGAGTCATCCAGAGCACCCAGGACGTCC
CTCTGGCCCTCACCACCAAAACCCGCTCAGATGTGCCCGT
CAACCTCAGCACTGGAGGCCGCAAGAGCCCCGCATCCGCG
TCCCCCACTCCCAACCGCAGCCGCGAACCCCGGAAGACCA
AGACTCCCAAAGCTCTGGAGGCCTGGAAGGGTCTGTCCCA
GAACCACCTGGTGCAGTCACTGGTGGACCTGTTTCAGCAC
AGCGGAGCCGAGCAGGAGGTGCCTAGCAGTAAAGACTCAG
ACGATTCTGCTGAGGATGAAGATGATGAGGATGATGATGT
GGAGGATGAAGAGGACGATGATGAAGAGGATTCAGATGAC
AGTCTCTCAGAGTCGGACAGTAATTCAGACAGTGAGATGA
ATGGCTCTGAAGGCACAAAAAAGAAGCGCAAGGATGCGAG
CGCTGCGGAAATGGACACTGATGGAGAGAAGACTCCTCAA
AAACTCAACAAGAGCCTCCTCAACTCCTCCACCAATCACA
GCCTGTCTGACTGCCTGCCGCTAAACCTCCAAGTCGTTAA
GCCCGCCAGTGTGGCCACACCCACCATCGTGAGCAGCTCC
GGTGCCTATCACAGCTCTCCATCCTCCTCATACTCCGTTG
GCACCTCTCCAGGCTCGGCGAAGAGAAAGCGAGTGATGAA
TGAAGATGATTTACGGATTCCGCTGGAAATGGGTTGGCAA
AGAGAGACCAGGATAAAAACGGTGGCCGGTCGGCTGCAGG
GAGATGTTGCGTATTACTCCCCGTGCGGCAAGCGACTGCG
ACAGTACCCAGATGTCGTAAAGGGTCTGCAGTGGACTCTT
CTGAATGAGGAAGAGGTCATCCCTCATATATTGGCCATGG
AGGGGCGGCGAGGTCGCCCGCCCAACTCTGACCGCCAGCA
GAGGGGCAGCAGCGAGGGCTCGGGCAGTCGGCGCAGAAAG
GGTCGCCCTCCGAATCTAGGAGAGAACGAATTCCCAAGCC
CCTCCGAAGCTAAACTACTGCGCAAACTCGAGGCTCAGGA
AATCGCCCGGCAGGCAGCTCAGATGAAGCTCATGAGGAAA
CTAGAGAAGCAGGCACTGGCGCGGGCGGCCAAAGAGGCGC
GCAAACAGCAAGCCATCATGGCCGCAGAGGAGAGGAGAAA
GCAAAAGGAGCAGCTGAAGATACTTAAACAGCAGGAAAAG
ATAAAGCGTATTCAGCAAATCCGCATGGAGAAGGAACTCC
GCGCACAGCAGATTCTCGAGGCAAAGCGGAAAAAGAGAGA
GGAGGCTGCCAATGCCAAAATGTTGGAGGCGGAAAAGCGA
ATAAAGGAGAAGGAGATGAGACGCCAACAGGCTGTTATTC
TCAAGCACCAGGAGATGGAGAGGCATAGACTAGATATGGA
GAGGGAGAGGAGGAGACAGCACGTTATGCTAATGAAAGCT
GTGGAGGCTCGGAAAAAAGCTGAGGAACGCGAACGCCTCA
GGCAGGAGAAACGTGACGAGAAACGGCTCAACAAAGAGCG
CAAAATGGAGCTCCGGAGGCTGGAGCTGGAGATGATCCGT
GAGATGAAGAAGCCAAATGAAGACATGTGTTTGACGGATC
ACAAGCCGCTTCCGGGGGTTCCTCGTATCCCGGGTCTGGT
TCTGCCTGGCAGTGTGTTTTCAGATTGCCTGATGGTGGTG
CAGTTCCTGCGGAGCTTTGGGAAGGTGTTGGGCCTGGACT
CCTCTGAGTTGCCCACTCTGGGGATCCTGCAGGAGGGGCT
GCTCAACCTGGGCAACAGCATGGGCCAGGTGCAGGACCTG
CTGGTGAGACTGCTCTCGTCTGCGGTGTCTGACCCAGGAC
TGCCTCAAGGACACAGGGCCAAGTCTATCTTGGGTGACCA
CCTGACCAATGTGGGTCTGAATCGGGACAATGTGTCAGAG
GTTCTGCAGCTCTACATGGAGGCTCACTGCTCTCAGACTG
ATCTAGCGGATCTGACTCTGAGTTTGAGGACCAAAGCCTT
CCAGGCCCACACGCCGGCTCAAAAAGCCTCTGTCCTGGCC
TTCCTGGTCAATGAGCTCTCGTGCAGTAAAAGCGTGGTCA
GTGAGATCGACAAAAGCCTGGAGCACATGAACGTGCTGAG
GAAGGACGAGTGTATTGTGGAGGGCAAATTGAAAAAAATG
AAAACAATCTACGCAAAGCGGACAGGGAAACGGGAATCAA
TGACTGGAGGGGAGGAGCCTCACGCTGCCGGAGGCTCTGC
CATCGGTCACAAACGCAAGAGGAAGGCGGGCGATAGTGAT
GATGACGATGATGAAGATGAGGACAGCGATGAGGATGAGG
ATGATGAGGAGGAGGAGGAAGAGACTAAAAAGGGAAGGAG
GGTGGAGACATGCGATGAGGATGAGGGAGACCCAGCCACT
AGTGTTGAAGAGCTGGAGAAACAGATTGAAAAGATATCAA
AGCAACAAAACCTAATCCGCCGGAAGCTGTTTGAGTCGTC
TCACGCCCTGCGGTCCATGTCATATGGACAAGACCGGTTC
CGCCGCAGATACTGGATCCTGCCACAGTGTGGAGGAGTTT
ACATAGAGGCCTTAGAGAGTGGAGAAGGTCTGGAGGAGCT
AGAGAAAGAGCGCGAGAGGTTGAGGAACTGTCCGGTTGTG
CAGGTCAAAGAGGAGCCCAAGGAGGAAGTCCTGCAGCATC
ATCAGCACGAGGAGATACAAGGGACACTGAAAGAGGAGGT
CAAACAGGAGGAGGAGAAGCCCATGGATCTGGACCAGGAG
CCAAATAAAGAGGCACGCTCCTCCCCTCTAAAAGACAAAA
CAGATGTTGTGGCCACACCCCCTCAACTACCAGAACTCCG
CCTCTCACAGAGCCCTCAGTGTCAGGAGCCACCTCACACG
CCACGCCATGCCCACAACGGCTGCTCGGCAACAATCGCCA
TGGACATGACATCAGGATCGTCTCCAGCTCACTCTCCAAC
TACCTCCAAGCTGACCGAGGCCAGCAGCCCAAACGCAGAG
CACGCAATCCCTCCGCCTCTGCAGCTAGGCATCCCTGCGC
ACCTCCTGCAGCCGCAGCTGGCGCAGACTCAGCTCCTCGC
CAGCGACCAGCTCTACAAGGTTCTCAGCGAGCGCAGCGGA
CACTGGTTCAGCCTGCTGCCTCGCTCACCCTGCGACGACA
CTTCCCTCATCCAGCCGTCTGCGCACCCGCAGTCCTCGCC
TAAAAGCAACGCCACAAACACACGGCCCAAATCTCCACCT
CCACCGTCTACCTCTTCCCCGCACCATCACCTGCTTCCTC
TGTCTGCGTCTGCAAGCCCACTGAACCCCACAGCTGCAGC
CGGGATCAGCAACCTCAGTGTGCAGGTGAAGCCAGGTGCA
GCTCTGGTGGGTTTGCCTTTGTACAGCTGGTCTGGTGGGG
TCATCAGCCCCAATCTCCCCCTGTGCAGCAGCCCCCTGCA
CATGTACCCATCAGTAGAGGGCAGCGCCAGCCCCCTCCTG
GCACCCAGCGTCTCAACCAGCAAAAGTGGCTCTCCTGTTC
CCACCGCGGAGAAGCTGGCATCTGCTCCTTCTCCAGTGGC
GCTGGACCTTCCCAGAAATCATGACCTGCCTGAGCCAATG
GCCATACCAGAGGACATGCTGCTGGGCTGGTGGAAGGTGA
CAGACATGGAGGAGCTGAAAGCGCTAGTGAACTCTCTTCA
CAGCAGAGGTATCCGAGAGAGAGCCCTGCAGAAACAGCTG
CAGAAGTCCATGGAGCTCATCGTACAGACCTGCAACAAGA
ACCGAGAGGTGGCAGTTATGGAGGTCTCAGAGCTCGACGA
GGGCCAGGTTTCCGTGGAGACGCTGCAGGAGTGGTGCGTG
GAGGAACAGGCCATGGAGACTGACATTGCTCTGCTGCAGC
AGGTGGAGGAGCTGGAGCGCAAAGTCACGTCTGCCAGCCT
GCAGGTCAAGGGCTGGACATACCCAGAGCCGCAGTCTGAG
AGAGAGGACCTTGTCTATTTCGAGCACAAGCCCCTCCCCA
AGCACCGCCCTGGGGCGGAGTCTCAGGAGGAGCGCAGCTC
GGAGAAGGGTCTGATCCGGCGCCCCAGCAACCCGCTGGAC
ATCGCTGTGATGCGGCTGGCAGAGCTGGAGCGCCACATCG
AGAGAAGGTACCTGCGGAGCCCCTTAGGGACCACCATCCA
GATCAAACTGGATAATGTGGGTACAGTCACTGTCCCCGCA
CCTGCTCCATCCACTAGCGCTGGAGGGGAAGGGGGAGAGG
AAGAGATTGCTCCAGGAATGAAGCTCTGGCGGAAAGCTTT
GAGTGAGGTGCGCAGCTCCTCTCAGCTGGCCATGTGTCTG
CAGCAGCTGCAGAAGTCCATCGCCTGGGAAAAGTCTATCA
TGAAA

baz2ba TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA baz2ba-202 6285
baz2ba-203 (1)    Ensembl 364
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
baz2ba-202 Contained in:
[BAC] CH73-209M22 (1), DKEYP-15G8 (1)

Genome Resources: Vega_Trans:OTTDART00000054520 (1),  Ensembl_Trans:ENSDART00000151044 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC142904 (1) 1533 nt
GenBank:BC134195 (1) 1122 nt
GenBank:DT883212 (1) 845 nt
GenBank:CT678360 (1) 838 nt
GenBank:CK145817 (1) 804 nt
GenBank:CO923824 (1) 720 nt
GenBank:CT684629 (1) 689 nt
GenBank:AI658285 (1) 562 nt
GenBank:EB949837 (1) 450 nt
GenBank:EB918007 (1) 441 nt
GenBank:FP137043 (1) 421 nt
GenBank:EB948569 (1) 291 nt
CITATIONS (2)