header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-120213-649
Transcript Name: fkbp9-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000054171 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000054171|OTTDARG00000015706|ZDB-GENE-040801-23 fkbp9|no_translation fkbp9-002 LG_ CR749752.5 Danio rerio protein_coding KNOWN, 634 bp
ATCGGCAAAGGCTATGTGATCGCAGGAATGGACCAAGGGC
TTCTGGGTGTGTGTGTTGGAGAGCGCAGAAGGATTACTAT
CCCACCTCATCTGGCATATGGAGAGGAGGGCACCGGAACT
AAGATCCCTGGATCAGCTGTGCTGGTGTTCGATGTCCATA
TTATTGACTTCCACAACCCCTCTGATACAGTGGAGATCAC
CAGCGTGAAGCCGGAGAACTGCACTTACAACGCAAAACGT
GGAGACTTTGTCAAATACCATTACAACGCCACTCTCATGG
ACGGCACTGACATCGGCTCCACGCACATGTATGGTAAGAC
GTATAATGTGGTTCTGGGATCCGGACAGGTTGTCATAGGA
ATGGAGCAAGGCCTTACGGGAATGTGTATCGGAGAGAAGC
GCAAGCTAGTTATTCCACCTCACCTTGCATATGGAGAGAG
GGGAGTGGTGTAGTATCTGTGTGCTCAGATGGAGAGGTGC
CTGGCAGTGCAGTGCTGGTGTTTGAGGTTGAGATGGTGGA
TGTGGAGGAAGGTCTTCCTGAAGGCTACATGTTTGTGTGG
AATAACAACGTCACACCTGACCTCTTCAGTGAAATGGACA
AGAACAAAGACGCACAAGTGGACAAAACTGAGGT

fkbp9 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA fkbp9-002 634
mRNA fkbp9-201 (1) 2213
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fkbp9-002 Contained in:
OTHER fkbp9-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000054171 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BI889566 (1) 694bp
    CITATIONS (1)