header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-4209
Transcript Name: fkbp9-201
Previous Name: fkbp9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000018818 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000018818|OTTDARG00000015706|ZDB-GENE-040801-23 fkbp9|OTTDARP00000015897 fkbp9-001 LG_ CR749752.5 Danio rerio protein_coding KNOWN, 2213 bp
ACGTATAAAGCATTCCAGCCTCCAGACCCGCGTTTCCGCA
TTTCCCTGCAAATACGAAGCTTTTCCTGCGTAATCTCCGT
TCCCCGTGTAAAGCGACACCGGACACATCGGAAGAAGTTT
GAGGGAGTTTGAGGATCCGTCCACCACGTCTACACACTTC
AATCGCGTTAGAGAAGCTGCTGCAACGCATTACAGCAGCA
ACGAGCCATTCCTTTGCACAACACAAACGGAAGATGATAC
GGTTGATACAGATGATTCTCCTGGCTTTCCTAGTGACTTT
TGTGGCTTGCAACGCGCCGCCGGTACCGTTAGATGACATC
GTGATAGAGAAGACCTTCACCCCGGAGCGCTGCGAGCGGG
CGGTCAAATCCGGAGACTATGTTCGGTATCATTACATCGG
CATGTTTCCTGATGGAAAGAAGTTTGACTCCAGTTATGAC
CGTGGAAACACCTATAACGTGTTTGTCGGCCAGAAGCAGC
TGATCGCTGGGATGGACAAAGCTTTAGTGGGGATGTGTGT
TAATGAGCGATGGATGATCAAAATCCCTCCACAGCTCGCC
TACGGAAAGGATGGTTACGGTGACATCATCCCTCCAGACT
CCATCCTTCACTTTGATGTGCTGATGTTGGATATTTGGAA
CAAAGAAGACAAGGTGCAGATAAAGACCTACCACATGCCG
GAGAGCTGTGAGCGAAAAGTACAAGTGTCTGATTATATCC
GCTACCACTACAATGGCACTCTGCTTGATGGCACGCTGTT
CGACTCCAGTCACACACGCATGCGCACCTATGACACTTAC
GTGGGCATTGGCTGGCTGATTGCAGGAATGGACCAGGGGC
TTCTAGGAATGTGTGTGGGAGAAAAACGCATCATCACCTT
GCCACCTTTCCTGGGCTATGGAGAGAATGGAGATGGAAGT
GACATCCCCGCTCAGGCTTCTCTGGTGTTCGATGTGGTTC
TGCTGGACCTTCATAACCCCAAAGATGAAATCGCAGTAAA
GGTAGAATACCTTCCAGATCCTTGTCCACGCAAGAGTCAA
GTTGGAGACTTCATGCGTTATCATTATAACGGCTCTCTGC
TGGACGGCACTTTCTTCGATTCCAGTTACTCAAGGAATCA
CACATATGACACTTATATCGGCAAAGGCTATGTGATCGCA
GGAATGGACCAAGGGCTTCTGGGTGTGTGTGTTGGAGAGC
GCAGAAGGATTACTATCCCACCTCATCTGGCATATGGAGA
GGAGGGCACCGGAACTAAGATCCCTGGATCAGCTGTGCTG
GTGTTCGATGTCCATATTATTGACTTCCACAACCCCTCTG
ATACAGTGGAGATCACCAGCGTGAAGCCGGAGAACTGCAC
TTACAACGCAAAACGTGGAGACTTTGTCAAATACCATTAC
AACGCCACTCTCATGGACGGCACTGACATCGGCTCCACGC
ACATGTATGGTAAGACGTATAATGTGGTTCTGGGATCCGG
ACAGGTTGTCATAGGAATGGAGCAAGGCCTTACGGGAATG
TGTATCGGAGAGAAGCGCAAGCTAGTTATTCCACCTCACC
TTGCATATGGAGAGAGGGGAGTGGATGGAGAGGTGCCTGG
CAGTGCAGTGCTGGTGTTTGAGGTTGAGATGGTGGATGTG
GAGGAAGGTCTTCCTGAAGGCTACATGTTTGTGTGGAATA
ACAACGTCACACCTGACCTCTTCAGTGAAATGGACAAGAA
CAAAGACGCACAAGTGGACAAAACTGAGTTTTCAGATTAC
ATCCTCCAGCAGGTAGAAGAGGGCAAAGGTCGTCTGGCGC
CAGGTTTCGAATCGCAGCGCATCATCGAGAGCATGTATGA
TAATCAGGACCGCAATAAAGATGGAATAATCACAGAGGAC
GAGTTTAAACTCAAAGCAGACGAAGCAGCAGCTCATGACG
AGTTATAAGACTGGACTCTGGGATGGAGGGTTGTGATTGG
TTGTGTGTGGTTTAATATTATAATAAGTGGGAGGGGTATA
AAGATATTGAATTTGCCAGTGAAGTGTCGCTCAGTGATGT
TGATGCCTTGTTTGTCTGAGAGGTGTGTGTGTGTTTGTGT
GTTCATAAGTGTGTTTATATATGACTTTTTTTCTATGTGA
CTTGAAATGTTTGTCTGGAGTGGTGATACAAATGTGCAAA
ACTTTACTTTGTAAAAAAAATCCCTTAAATAAACACATTC
CAACCCCCCAAAA

fkbp9 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA fkbp9-002 (1) 634
mRNA fkbp9-201 2213
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fkbp9-201 Contained in:
OTHER fkbp9-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000018818 (1)
  • Ensembl_Trans:ENSDART00000004392 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC078307 (1) 2150bp
    GenBank:CK681615 (1) 850bp
    GenBank:CD777894 (1) 585bp
    GenBank:CK674631 (1) 465bp
    GenBank:AI416290 (1) 420bp
    GenBank:AI617821 (1) 400bp
    GenBank:AI626240 (1) 380bp
    GenBank:AL727909 (1) 345bp
    CITATIONS (2)