Transcript

zgc:92360-002

ID
ZDB-TSCRIPT-120213-641
Name
zgc:92360-002
Previous Names
  • ch73-379f7.3-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054120 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054120|OTTDARG00000037824|ZDB-GENE-040718-470 zgc:92360|no_translation CH73-379F7.3-002 LG_ FP015829.10 Danio rerio protein_coding KNOWN, 894 bp
CTTGTTTTAAGCACAAACAACCTTCGGTTTGACTCATTAT
TTCTGAAAACAACACTATATTTTGTGCTTGTCTAGAAAAT
GCTGACTGATTTAAGAATTTTTATACATTTAAACTAGAAA
CAAGACAAAAACTCTTAAGTGACAAGCATTTTTCTGCAGT
GCACACTATGAGCTATGTACAAAAGAGCCTCAACTGCAGC
TCATCCACAGTGTTTGCAGTCTTATTATTTAAGTACGAGA
GGAGAGAGCGGACTGTCTGTTTCTTATTTGTGTTTCAGGA
TGCGTTTGCTAAAGGCGAGGTGTTTCTGGGACACAGGGAT
CACGGGTACCGCGTGACCATCGGTCTGCCTGCCGGCTCTC
ACTGTAATGGGGCGTGGCAGTTCGGCATCACCATAGAAAC
ACCTGAACGCAGCTTTCTGTTCACCTGTGAGACGGACACT
GAGCAGAAGGACTGGATGAGCCACTTCAACACACTCATCT
GCACACCTATGAGCCCGCAGGAGTACAGCGTGGAGGCGTA
CTTCAAACACAAACACTGACAGAGCTCAGCCTGCGGATCC
TCAGCACACACTCCACATCTCTACACTAAGTGTCCGTTTG
TACACTGCGTTATGAATTATGTATCGCTGAATTATGTATC
ATTAGATCGTGAAACCCTCAAACACTCCCATTGAACTTTT
TTTTAATGATCTCCTATAGCTGTGGTTCAGTCCTGGTTCT
GGAGACCCAAACATTTTCCTATGACTCTCCTATGTGGCAC
ATGCAGATCAGGTCATAGAGTTCTTAGTGTTTAAATAAAG
GAGATTACAGAGCGTTGCTTCCCAGGCCCAGGATTGAAAA
CCACTGTTCTAAACTGGCTGGAGCTTTGCTTTTGCACCAA
CTTCACTGAATAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations