Transcript

zgc:92360-201

ID
ZDB-TSCRIPT-120213-256
Name
zgc:92360-201
Previous Names
  • ch73-379f7.3-001
  • zgc:92360-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000054119 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000054119|OTTDARG00000037824|ZDB-GENE-040718-470 zgc:92360|OTTDARP00000042520 CH73-379F7.3-001 LG_ FP015829.10 Danio rerio protein_coding KNOWN, 2621 bp
CTCCTGTGCTTTACTTCCGAATGTTTGAAACACCTCCGGC
CTCCAGCGCCTCCTCCCGCCGCTCCTGCCTCCAGAACGGA
GACTCAGACCGGAGACCGACACCGGAGACCTGCCGCTGCA
CCGCACCGATGACCGACAACGAGCGCGCGGCCAGAAACCT
CAAACACGTCCTGCAGAAACCGGGGAACGGCAGCTGCGCG
GACTGCGGAGCCGACAATCCAGAATGGGGCTCTTGTTCTC
TGGGCGTCTTCATCTGTCTGGCCTGCTCTGGTGTTCATCG
CAGTATTCCCACAATCGGGAAAGTCAAATCCCTCCGACTG
TCCCGCTGGGAGGATTCAGAAGTTCAGTTCTTGTCGGAGT
GTGGAAATGACTTGATGAAGGCCGTGTATGAGGCTGCTGT
TCCTGTTTATTACTACAAACCCACACACAGAGACTGCCAG
GTCCTGAAGGAGCAGTGGATTCGAGCCAAGTACGAGAGGC
AGGAGTTCACGGAGGTGGGAAAAAAGCTGACCTATGAGGA
CGAGAGCAGAGATGGCATGCTAATGAAGAGGGGGCGGGAC
AACGGGCAGTTCCTCAATAGAAGATTTGTCCTTTCTGTGA
GGGAAGGCATACTAAAGTACTACACTAAACTAGATGCGAA
GGAGCCGAAGGCGCTGATGAAAGTGGACACACTCAATGCC
TGCTTCCAGCCGGATAAGATCGGGAACCCAAACGGCCTGC
AGATCACATACATCAAAGACAACATCACACGCAACATCTT
CGTATATCACGACAGCAGCAAGGAGATCGTGGACTGGTTT
AATTCCATCCGTGCTGCTCAGCTGCATTACCTGAAGGTGG
CCTTTCCTGGAGCCACAGACGCTGAGCTCAAACCCAAACT
CACACGCAGCTTCCTGAAAGAGGGATACATGGAGAAAACC
GGCCCACGGCAAACAGAGGGCTTTAAGAAGCGCTGGTTCA
CTCTGGATCATCGACGACTCATGTACTTTAAAGATCCCCT
GGATGCGTTTGCTAAAGGCGAGGTGTTTCTGGGACACAGG
GATCACGGGTACCGCGTGACCATCGGTCTGCCTGCCGGCT
CTCACTGTAATGGGGCGTGGCAGTTCGGCATCACCATAGA
AACACCTGAACGCAGCTTTCTGTTCACCTGTGAGACGGAC
ACTGAGCAGAAGGACTGGATGAGCCACTTCAACACACTCA
TCTGCACACCTATGAGCCCGCAGGAGTACAGCGTGGAGGC
GTACTTCAAACACAAACACTGACAGAGCTCAGCCTGCGGA
TCCTCAGCACACACTCCACATCTCTACACTAAGTGTCCGT
TTGTACACTGCGTTATGAATTATGTATCGCTGAATTATGT
ATCATTAGATCGTGAAACCCTCAAACACTCCCATTGAACT
TTTTTTTAATGATCTCCTATAGCTGTGGTTCAGTCCTGGT
TCTGGAGACCCAAACATTTTCCTATGACTCTCCTATGTGG
CACATGCAGATCAGGTCATAGAGTTCTTAGTGTTTAAATA
AAGGAGATTACAGAGCGTTGCTTCCCAGGCCCAGGATTGA
AAACCACTGTTCTAAACTGGCTGGAGCTTTGCTTTTGCAC
CAACTTCACTGAATAAAGCAGGGGTTTCCAATCTCTGTGC
TGGAGGGCCAGCGTCCCTCATAGTTTAGCTCTAAGTTCCT
TCAACACACCAGCCTGGAAGTTTCTAGTATACCTAATAAG
AGCTTGATTAACTGGTTCAGGTGTGTTTAACTGGAGTTGC
AACTAAAATATGTAGAACACCGGCCCTCCAGGATCGAGTT
TGGACACCCCGGGTTTAAAGCAGGGCAGCTCAACCCTGTT
CCTAGAGATCTACCTTCCTGCAAAGCTCAGCTCCAACCCT
GATCAAAGATACATGAAGCAATTTAACAGGACCTGAACAG
CACTTGATAATTACAGGCAGGTGTGTTTGAAATGGGTAAA
GGTCGATCTTCAGGAACAATGTTAAGCACCCCTAAAGCAT
AAAGGCTCCATCTAGTGGTGAGTTATTTATTGATCGTCTG
ACCCATTTATTAAAGCAAATGTTTAAGTGATGGTAGGAAT
AGTTCTGTCAGAAATGATCAATCTGTCATTCTGTATTTCC
CTCATGCTGTTTTAAAGGTTATGACTTACATTGTTCAGTA
TAAATATCTTAATTTGTAAGCAGAATCTTGCTGTTATATA
AGTTGATATAGCTCTGATTTTTTTTTCTTTGGCAAAAATT
GCCTTTAATTTTATTCTGTGGTGCAAACAGTCTTTAAATT
TGCAATAAAATGCAAAAATATTCACACCCCTGATTTATTT
TATGTTCCACAATGGTTTGCATTGGTTATCTGCCATATAA
TTCATTCATATGATTCCCCATATAATGAACAGGCTTTCAT
GGAAGTATTTGCTTTGTATTTTTTTCATAAATCTCATTGG
TTACTCTCAAACTCAAGTGTCACATGACAGCTCAGTCTGA
ATATTTGAATATGCATGGCCATAAGTGAGCTGCATATGAT
GCAAAGAAATAAACAAAGCAACACGAGGGTCAGCAAATGA
TGCCAGAATGATCTTTTCCATGAGGGATTAATGCAACTTT
TTAATAAAAGTATTGATCTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations