ZFIN ID: ZDB-TSCRIPT-120213-598
Transcript Name: ptprua-202
Previous Name: ptprua-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053670 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053670|OTTDARG00000017197|ZDB-GENE-060503-232 ptprua|OTTDARP00000042197 ptprua-002 LG_none AL929594.17,BX000467.10,CU633478.10,CU856379.4,CR848723.13 Danio rerio protein_coding KNOWN, 761 bp
TTTTGATGGCTGGGACATAAATGACAAGAAGGACAAGACC
AAGGGACGACATGACACCCTTTTAGGACAAGACCGCCATC
GTGTCAAAATGCATTCCCTCTTGGCTGATCCTAACTCAGA
CTATGTCAATGCAAACTACATTGATATTCGGATAAACAGG
GAAGGGTATCAGCGCTCCAACCATTTTATCGCAACACAAG
GGCCCAAGCAGGACATGATCTATGACTTCTGGCGCATGGT
TTGGCAGGAGAACTGCTACAGCATCGTGATGATCACCAAA
CTGGTGGAGGTGGGGAGAATGAAGTGCTGTAAATATTGGC
CTGATGACAGTGAGCTTTATGGAGATATTAAAATCACTTT
ACTGAAAACAGAAACGCTGGCAGAATACACCGTACGCACT
TTTGCCATGGAGCGGCGGGGTTATCCAGCCAAACATGAAG
TCTGCCAGTTTCACTTTACATCCTGGCCAGAACATGGTGT
GCCCTATCATGCCACAGGACTACTAGCCTTCCTCCGGCGG
GTCAAAGCCTCCACACCTCCTGATGCTGGGCCAGTTGTTG
TCCACTGCAGTATGGGTGCCGGTCGCACAGGCTGTTACAT
AGTATTGGATGTGATGCTGGATATGGCTGAGTGTGAAGGT
GTTGTGGACATCTATAATTGTGTTAAGACGCTTTGCTCAC
GACGTATCAACATGATCCAGACTGAGGAGCAGTATATATT
CATCCATGATGCCATACTGGAGGCCTGTCTGTGCGGAGAG
A

ptprua TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ptprua-201 (1)    Ensembl 5837
ptprua-202 761
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptprua-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000053670 (1),  Ensembl_Trans:ENSDART00000151254 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CV490199 (1) 776 nt
CITATIONS (2)