ZFIN ID: ZDB-TSCRIPT-090929-4858
Transcript Name: ptprua-201
Previous Names: ptprua-001, si:ch211-82g18.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000020722 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000020722|OTTDARG00000017197|ZDB-GENE-060503-232 ptprua|OTTDARP00000017510 ptprua-001 LG_none AL929594.17,BX000467.10,CU633478.10,CU856379.4,CR848723.13 Danio rerio protein_coding KNOWN, 5837 bp
CAGATCTGGGGTCTGTGCGGCGCGTTTCTGGATGAAACTC
AGTGGCGCAGCAGCAGGATATTTACCACACTCTACCACAC
TCGCTCACTGTATTTCACCTGTCTTTACCTGCTGGGCTAA
ACGCTGCAATGAATCTGTGCGCTGTTCTGCTGTTTCTCAT
CGCCAGGGTCTGTGCGGAAAGTCTGGAGGGGCCAACAGCT
GGCTGTACGTTTGAGGAAGACTCTGACCCCACACTCTGTG
AATACAGACAGGCACAGGAAGATGACTTTGACTGGCAACT
TGTACGAACCTACAGCTGGCCTCACATGACTTCTGACCTT
ATACGAGGCTCGTATATGCTGGTAAATGCTTCTCAGTATG
GTGCAGGACAACGGGCTCAGCTCATGTTACGTCCGCTGAG
TGAGAACGACACTCACTGCGTGCAGTTCAGTTACTTTCTG
TACAGCCGTGATGGACACAGTCCCGGGGGTCTGAACGTGT
ATGTGCGTGTAAACGGTGGCTCACGGGGAAATGCCGTGTG
GAATGTGTCTGGATCTCAGGGGCGGCAGTGGCATCAGGTG
GAGATGGCCGTCAGCACCTTCTGGCCTAGCGAGTACCAGA
TTGTTTTTGAAGCCACAATCTCCTCTGAGCAGAAGGGTTA
CATCGGCCTGGATGACATAGTGCTGTTAAACTACCCCTGC
TATAAAGTGCCTCATTTCTCCCGCCTTGGGGATGTGGAGG
TGAATGCAGGACAAAATGCCACTTTTCAGTGTGTGGCAAC
CGGACGCTCTGTTAAGACTGATCCCTTCCTCATGGAGAGG
CGTAATGGTGTTCTGATGGCCCCATACTCTGTGACGTCAT
CCATTGGTGAGCGGCGATTAGTTGCTTGGTTCCAGGTGGG
AGGAGCTCAGCGTGGAGAGCAGGACCTCTATAGGTGCATC
ACCCAGTCAACATTTGGAGCTGCAGTGTCGAACTTTGCTG
AACTTATTGTTAGAGTCCCGCCCACACCGATTGCTCCACC
CCAGCTGCTGCGCTCTGGCCCCACCTACCTGATCATCCAG
CTGAACACTAACTCTATAGTGGGCGACGGGCCGGTGATTC
GTAGAGAGATTGTGTACAGGGCCAGTCATTCACCCTGGTC
TGAAACACATGGAGTCAACTCACTGACTTATAAAGTTTGG
CACCTGGAGCCAGATACAGAGTATCGCATCAGTGTTCTTC
TTACTCGGCCTGGAGAGGGTGGAACCGGCCCGCCTGGACC
CCCACTGGTCAGCAGAACCAAATGTGCAGAGCCCATGCGT
CCCCTCAGAGGTCTGACGGCTACGGAGATTCAGTCGCGTC
AGCTGCTTCTTCAATGGGAGCCGGTTGGTTATAACCTGAC
GCGCTGTCATACATACTCCCTGTCGTTGTGCTACCGCTAC
TCCACTGCCACTGGAGGAGGAGCCGGTGGGAATAACGCCA
CAGTAAGGGAGTGTCTGTCAGTGGAGAGGAACACCTCCCG
CTTCACACTTCGAGATCTGCCTCCATTTCACACTGTTCAC
GTGAGACTGGCACTGGCCAATCCAGAGGGCAAGAAGGAGA
GCCGAGAGGTGACCTTTCAGACAGAGGAAGACATCCCAGG
AGGCATTGCACCGGAATCTTTAACCTTCACCCCACTGGAT
GATATGATCTTTCTGAAGTGGGAGGAGCCTCTGGAGCCCA
ATGGTCTGATCACACAGTATGAGATCAGCTACCAGAGCAT
TGAATCATCAGATCCCAGTATCAACGTTCCTGGCCCACGG
CGCACTGTTTCCAAACTTAAGAACGAAACATATCACATGT
TCTCCGGGCTTCATCCTGGCACTACATACCTGGTGTCTGT
TCGTGCCCGTACCGCTAAAGGCTTTGGCCAGACCGCCTTA
ACCGAAATTACCACCAACATCTCAGCCCCTGCATTTGATT
ATGAAGATGTTCCTTCTCCACTGAGTGAATCTGAAAGCAC
CATAACGGTCCTCTTGCGACCAGCCTTGGGGAGAGGAGCA
CCTGTTAGCACCTATCATGTGGTTGTGGTGGAGGAGGATG
GGTCCAGACAGGTGAGGCGGAGGGAATTGGGTCACATGGA
GTGTTTCCCTGCTCCTTCGTCCCATGGGGAGACTTCAGGA
GGGGCAGGTGGTACACCACCTCACTACTACACCGCTGAAC
TCTCGCCTAGCAGCTTGCCCGAGGCTACACCGTTCACTGT
GGGGGACAATCACACCTACAGCGGCTACTGGAACACACCT
CTAGATCCTAGCAAGAACTATCTCATCTACTTCCAGGCTT
CCAGTAACTTCAGAGGGGAGACAAGGATCAACTGCATTCG
AATCGCTCGTAAAGTGGCCTGTAAGGACCATAAGCGTGCT
TTGGAGGTGTCCCAGCATGCCGAGGACATGGGGCTGATCC
TGGGGGCCTGTGCCGGGGGCCTAGTTGTTCTCATTCTGCT
GCTTGGAGCAATTGTGGTTATTGTTAAGAAAGGAAGGGAC
ATCTATTCCTACCCCTACTACCCCAGGAAGAAGGTCAACA
TAAACAAAGCGGTGATGACATATCGTCAGGAAAAGACGTG
TAAGCTGGGGTCATTGGACTGCAGTACGACAGAGCACAGT
ACACTTCAACAGGATGATCGCACTGCACACACCTTCCTGG
ACTCTCATAACTGCACTGCTAGGAACGAGCAGCGCAGCAC
TGTCAATGAGTCCAGCAGCCTGCTGGGTGGTTCTCCCAGA
AGGCACTGCAGGAGAAAAAGTTCCCCGTACCACACAGGGC
AGCTCCACCCGGCTGTGAGAGTGGCAGATCTGCTCCAGCA
CATCAACCAGATGAAGACAGGCGAGGGGTACGGCTTCAAA
CAGGAGTATGAGAGTTTTTTTGATGGCTGGGACATAAATG
ACAAGAAGGACAAGACCAAGGGACGACATGACACCCTTTT
AGGACAAGACCGCCATCGTGTCAAAATGCATTCCCTCTTG
GCTGATCCTAACTCAGACTATGTCAATGCAAACTACATTG
ATGGGTATCAGCGCTCCAACCATTTTATCGCAACACAAGG
GCCCAAGCAGGACATGATCTATGACTTCTGGCGCATGGTT
TGGCAGGAGAACTGCTACAGCATCGTGATGATCACCAAAC
TGGTGGAGGTGGGGAGAATGAAGTGCTGTAAATATTGGCC
TGATGACAGTGAGCTTTATGGAGATATTAAAATCACTTTA
CTGAAAACAGAAACGCTGGCAGAATACACCGTACGCACTT
TTGCCATGGAGCGGCGGGGTTATCCAGCCAAACATGAAGT
CTGCCAGTTTCACTTTACATCCTGGCCAGAACATGGTGTG
CCCTATCATGCCACAGGACTACTAGCCTTCCTCCGGCGGG
TCAAAGCCTCCACACCTCCTGATGCTGGGCCAGTTGTTGT
CCACTGCAGTATGGGTGCCGGTCGCACAGGCTGTTACATA
GTATTGGATGTGATGCTGGATATGGCTGAGTGTGAAGGTG
TTGTGGACATCTATAATTGTGTTAAGACGCTTTGCTCACG
ACGTATCAACATGATCCAGACTGAGGAGCAGTATATATTC
ATCCATGATGCCATACTGGAGGCCTGTCTGTGCGGAGAGA
CTGCCATCCCCATCACTGAGTTTGGGCTCTCATATAAGGA
CATGTTGAGTGTGGATTCTCAGACCAACACCTCTCAACTT
CGAGAAGAATTTCAGACTCTAAACTCTGTCACTCCGCACC
TGGATGTGGAGGAGTGCAGTGTCTCTCTGCTGCCCCGGAA
CCGGGAAAAGAACCGGAGTATGGACGTGCTGCCTCCTGAC
CGTGCACTTGCGTTTCTTGTCTCCAATGAGGGCGACGGCA
ACAACTACATAAACGCAGCATTGATGGACAGCTTCCTTCA
GCCTGCTGCATTTGTGGTGACCCCACACCCCCTGCCCACC
ACCACCACAGACTTCTGGAGACTCGTGTTTGACTACGGCT
GTACCTCTATCGTCATGCTCAACCAACTAAACCAGTCCAA
CTCAGCATGGCCTTGTCTACAGTATTGGCCTGAAACGGGA
ATGCAGCAGTATGGACCCATGACTGTGGAGCTGCTCTCCA
GATCTACCGATGAGAATGTCGTCACTCGTCTATTCAGGGT
GAATAACATCACACGGTTGCAGGAAGGTCATCTGGTAGTG
CGACATTTCCAGTTCCTGCGCTGGTCAGCTTACCGTGAAA
TTCCAGACTCAAAAAAAGCCTTTCTTAACCTGCTGGCACA
AGTGCAGAAGTGGCAGAGGGAGTGTGGCGATGGTCGCACT
ATTGTGCACTGCCTGAATGGTGGGGGACGTAGTGGCACTT
TCTGTGCTTGCACCATGATAATGGAGATGGTGCATCATCA
CAACATGGTGGATGTGTTCTACGCTGTCAAGACTCTCCGC
AACTCCAAGCCCAACATGGTGGAGTCTATGGAGCAGTACA
GGTTCTGCTATGAGCTGGCTCTGGAGTACCTGGACTGCCT
GGAGGTCAGATAACACAAGAGCTCAACACTTGATCAACAC
TGGCTTCGACTTCTACTTGCCTCTTCTTCTTTTTTTTTTT
TTTCTTTTCTTTTCCTTTTGCTTGGGTCAGTACAGCCCAT
ATGAATGAGCCTTTATGTCCTCCAGTGAGAAGGCACATCT
ACTATAAGAGTGGGAATGCAAAACTTGGCACATTTCTTAA
ACCTTTAACCTCTATTGTCTTCTGTGCTATTTTTGTTTTT
GACATTTTCTGTGCCAGATATTCCTGCCAAACCCTTGAGG
ACACTGATGAGATTTCAACAGCTTTGAGATTATGACATAT
ATCTTTGATAACATGACTAGCTCTGAGCTCTGCCTCTCTC
TGCCTTATACACCAAGCAGGAGGAAAACACACTGAATTTT
AACGAAACCATGGGGCTGCAACAGTGGCAACATGAGTGAT
ATTGTGTTTGTACATTAAGTGTATTGTTTAACTCTCTATG
GAGCGATCTACTGTGGTGATTTTAGTAGAAAGCTTACCAT
GAATTTGAAGAGACAGTGGCTCATGTAAGTTTACGTTTTA
CTGAATTTACTTAAAAGGTGATGTGTGTAATTTTTTGATG
TTAATAATTTGCTGGGATTGGTTGAAGTGTTGAGACAATG
AATTGATTCTTGTCAAAATTGAAACACCTTTGCACTAATT
AAACATTATTTGAATTGTTGATCAACCAATGGCATGCGTT
TGGGGTGTCAATATTTGTTTGTCTGACAAATTACAGATCG
AGAATTTTTTTTTTTCTTTTGCAAAAGTGTAATATTTGTG
GCAAAAAAAGTACACACTTCACCTTTAAGTCAAAGTGACA
TTTAAAAATTGAAAGTGTCCGAATTTGGACAGGCAAGTCG
GAACTATAGGTATGGAGATGGTTTCTGGGGTTAATTCTTG
TTTTTTTGTGTGTGTATATAGGGTATATTTTGCAAAAAAA
AAAAAGAAGAGAGAGAAATGTTTCTCGATGTTGTCTTTAA
TGTGCCAACTCATTTTGTATGTGTGTGTGCGTGTGTGTGT
GTGTGAGAGAGAGAGAACGCATGTGTGTATGCGTGTGCAA
AGATCACTCATGGATCTGCATGCCTGTTTCATGTTTTAAT
GCAATCCATTGTGACCCGTCTGCTTTGGGTGTCGCTGCCC
ACTGTCATTGAGCACAGTAAAAGAAAAAGATTTGCGCAAT
TATATAAACAAAAATGCTACTATTGGAATACAGTGAGGCT
CCTCACAAAAACGTTGCTTTTTATCTTTGTATTTATTGGT
TGTGTTTTATTTTCTAAAAAAAAAAAGTGAACGAATAAAA
CATTCCGATGTTACTTTTAAATTGTTGTCATTATTGT

ptprua TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ptprua-201 5837
ptprua-202 (1)    Ensembl 761
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptprua-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000020722 (1),  Ensembl_Trans:ENSDART00000137189 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:DN770602 (1) 791 nt
GenBank:AL918943 (1) 477 nt
GenBank:FN665786 (1) 326 nt
GenBank:EB781320 (1) 135 nt
CITATIONS (2)