ZFIN ID: ZDB-TSCRIPT-120213-473
Transcript Name: krtt1c19e-202
Previous Names: dkeyp-113d7.4-002, krtt1c19e-002, si:dkeyp-113d7.4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000053194 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000053194|OTTDARG00000014147|ZDB-GENE-050506-95 krtt1c19e|OTTDARP00000041846 DKEYP-113D7.4-002 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 591 bp
GTACTCACTCTTCAGGCAGAGCAGAGTAAGACACCAACCA
CCATCCACATGGCTACCACCTTCTCCAGCGGAAGCTTCGT
TTCCAGCAGGAGGCGCAGGGGTCCGCATCTCCAGTGCATC
CCGCTCCATGTCCGCAGCAGGATCAGGAGGTAACTTCGGC
TTTGGAGGTGGATTTGGGTCTGCAGGTGGTGCTGGTGCAG
GGTTTGGGGCTGGTGGAGGATTTGGTGCTGCAGCAGGAGG
AGGATTCTGGGGAATCGGTGCCTCTGGAGCAGCAGATGAC
AGCATCATTGGCAATGAGAAGTTCACCTTGCAGAATCTCA
ACGACCGTCTGGCTTCATACCTGGACAAGGTGCGCTCTCT
TGAGAAAGCCAATGCTGAGCTAGAGTTGAAGATACGGGAG
TTCCTGGAGAACAAAATCTCTCCTACTGGAGCTGCACGTA
ACTACTCTGCCTTCGAGACTGTTGTCAGTGACCTCCAGGC
TAAGATCTTGGCCGCCATACAGCTGAATAACACTGTTCAC
CTCAGTATTGACAACTCCAGCTTGGCTGCGGATGACTTCA
GAATAAAATATGAGAATGAGCTGAGCATGCG

krtt1c19e TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA krtt1c19e-201 (1) 1576
krtt1c19e-202 591
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krtt1c19e-202 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER krtt1c19e-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000053194 (1)
  • Ensembl_Trans:ENSDART00000151398 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EB853464 (1) 593bp
    CITATIONS (2)