ZFIN ID: ZDB-TSCRIPT-090929-3567
Transcript Name: krtt1c19e-201
Previous Names: krtt1c19e-001, si:dkeyp-113d7.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000016879 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000016879|OTTDARG00000014147|ZDB-GENE-050506-95 krtt1c19e|OTTDARP00000014308 DKEYP-113D7.4-001 LG_ BX323079.7 Danio rerio protein_coding KNOWN, 1576 bp
ACTCACTCTTCAGGCAGAGCAGAGTAAGACACCAACCACC
ATCCACATGGCTACCACCTTCTCCAGCGGAAGCTTCGTTT
CCAGCAGGTCCTCCATGGGCTCCTCGCGCCTCTCTTCTTC
AGGTGGAGGAGGTGGCCGCATCAGCGCCATGAGGTCTGGC
AGTGTGTATGGAGGTGCAGGAGGCGCAGGGGTCCGCATCT
CCAGTGCATCCCGCTCCATGTCCGCAGCAGGATCAGGAGG
TAACTTCGGCTTTGGAGGTGGATTTGGGTCTGCAGGTGGT
GCTGGTGCAGGGTTTGGGGCTGGTGGAGGATTTGGTGCTG
CAGCAGGAGGAGGATTCTGGGGAATCGGTGCCTCTGGAGC
AGCAGATGACAGCATCATTGGCAATGAGAAGTTCACCTTG
CAGAATCTCAACGACCGTCTGGCTTCATACCTGGACAAGG
TGCGCTCTCTTGAGAAAGCCAATGCTGAGCTAGAGTTGAA
GATACGGGAGTTCCTGGAGAACAAAATCTCTCCTACTGGA
GCTGCACGTAACTACTCTGCCTTCGAGACTGTTGTCAGTG
ACCTCCAGGCTAAGATCTTGGCCGCCATACAGCTGAATAA
CACTGTTCACCTCAGTATTGACAACTCCAGCTTGGCTGCG
GATGACTTCAGAATAAAATATGAGAATGAGCTGAGCATGC
GTCAGTCTGTGGAAGCTGACATCGCTGGGTTGAAGAATGT
TCTCAGTGACCTCAACATGGGCCAAAAAGACCTCAATCTG
CAGATCGAAGCCCTCACTGAGGAGCTGGCCTACATGAAGG
CGAATCACCAGGAGGACCTCTCGACCTCACGCGATCAAAT
GAGTGGACAGGTCAACGTGGAGGTTGATGCCGCACCACAG
GAAGATCTCACCAAAGTTTTAGCTGACATACGCGAGCACT
ATGAGACTGTTGTGTCCAAGAGCCAGAGGGAACTTGAAGG
CTGGTTCCAGCAGAAGTCTGAGACTTTGAAACAGGAGGTT
GTAGCGAGCACAGAGACCCTGCAGACTTCAAAAACCGAAG
TCAACTCAGTCAAGAGCTCAGTACAGTCCCTGGAGATTGA
GCTTCAGTCTCTCCTTGCAATGAAATCATCCATGGAGGGC
ACTTTGAATGATACTCAGAATCGCTACTCCATGCAGCTCT
CTGGCTACCAGGCACAGGTGAGTGGAATGGAGGGTCAACT
TGTGCAGCTCCGCGCTGATCTGGAACGCCAAGGGCAAGAG
TATCAGATGCTTCTGGACATCAAGACCAGGCTGGAGATGG
AGATCGCAGAGTACAGAAGACTGCTGGATGCAGAAGCCAG
CGGCAGCCTTGCAATTTCTAGCAAATCGGGCTCCAGCTCC
ACTTCCAGCTCCACCACCAGCACCACTAAAACAGCAGTGA
TCACTGTTGTGGAAGAGGTGATTGATGGAAAGGTGGTTTC
TTCCTCTTCCACGTCCCTTGTTAAGTAAAGCACACCAGAT
TCATGTCGGGTAAAGAAACATCGCGCTCCTAACATGCTGT
CAAAATGTGGTGGTTGTCTTTGAGCATTTACAACAATAAA
GCTAACGTCAAAGACA

krtt1c19e TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA krtt1c19e-201 1576
krtt1c19e-202 (1) 591
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krtt1c19e-201 Contained in:
[BAC] DKEYP-113D7 (1)
OTHER krtt1c19e-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000016879 (1)
  • Ensembl_Trans:ENSDART00000066620 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC116529 (1) 1605bp
    GenBank:BC134001 (1) 1605bp
    GenBank:BC092980 (1) 1603bp
    GenBank:CK140262 (1) 843bp
    GenBank:BQ419035 (1) 629bp
    GenBank:AL922685 (1) 539bp
    GenBank:EB976778 (1) 533bp
    GenBank:AL727208 (1) 418bp
    CITATIONS (2)